Molecular Vision最新文献

{"title":"Evaluation of the Algerbrush II rotating burr as a tool for inducing ocular surface failure in a mouse model.","authors":"Athar Shadmani, Trent Jarin, Xiang Qi Meng, Yugendran Rajaendran, Salih Uzun, Albert Y Wu","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The Algerbrush II has been widely used to induce corneal and limbal injuries in animal models. The extent of injury varies with the duration of exposure, pressure from the placement of the burr, and the size of the burr. However, no study has explored the correlation between the duration of exposure and the severity of injury in mouse model with corneal and limbal stem cell deficiency (LSCD) induced using the Algerbrush II. Therefore, this study aimed to evaluate the variations in the severity of corneal and limbal injury with different durations of the Algerbrush II application.</p><p><strong>Methods: </strong>The entire cornea and limbus of C57BL/6 mice were injured for 30-45 s, 60-75 s, 90-120 s, and 3-4 min. Photography and slit-lamp examination was performed on days 0, 2, 4, and 7, followed by hematoxylin & eosin, periodic acid-Schiff, and immunohistochemical staining. Statistical analysis was performed using one way ANOVA analysis.</p><p><strong>Results: </strong>A duration of 30-45 s of injury was found to be sufficient to induce superficial corneal and limbal epithelial debridement and re-epithelialization was completed in all eyes by day 7; however, clinical signs of LSCD were not observed in all mice. Increasing the exposure time to 90-120 s resulted in central 2+ corneal opacity with limbal and paracentral corneal neovascularization. All eyes injured for 3-4 min displayed clinical signs of LSCD, such as persistent epithelial defects on day 7 after the injury, central corneal neovascularization, and 2.2+ diffuse corneal opacity. Histological signs of LSCD, including goblet cell metaplasia and K13 expression on the corneal surface, were observed in all injured eyes.</p><p><strong>Conclusions: </strong>Our findings suggest that the duration of injury is an important factor influencing the severity of LSCD in a murine model of injury. A 1-mm rotating burr was found to be more effective for keratectomy and pigment release, whereas a 0.5-mm burr was more suitable for corneal epithelial debridement.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"256-265"},"PeriodicalIF":2.2,"publicationDate":"2023-11-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784216/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466190","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"<i>GPR143</i> mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.","authors":"Jingling Xu, Yihan Zheng, Lulu Cheng, Huihui Sun, Xinping Yu, Feng Gu, E Song","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. <i>GPR143</i> is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.</p><p><strong>Methods: </strong>A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of <i>GPR143</i>. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.</p><p><strong>Results: </strong>Genetic analysis identified 11 <i>GPR143</i> mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a <i>GPR143</i> mutation were found to present a typical or atypical phenotype of OA1. All patients with <i>GPR143</i> mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.</p><p><strong>Conclusions: </strong>We discovered seven novel mutations and four previously reported mutations of <i>GPR143</i> in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"234-244"},"PeriodicalIF":2.2,"publicationDate":"2023-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784212/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139465935","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Protein modeling and in silico analysis to assess pathogenicity of <i>ABCA4</i> variants in patients with inherited retinal disease.","authors":"Senem Cevik, Nutsuchar Wangtiraumnuay, Kristof Van Schelvergem, Mai Tsukikawa, Jenina Capasso, Subhasis B Biswas, Barry Bodt, Alex V Levin, Esther Biswas-Fiss","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The retina-specific ABCA transporter, ABCA4, plays an essential role in translocating retinoids required by the visual cycle. <i>ABCA4</i> genetic variants are known to cause a wide range of inherited retinal disorders, including Stargardt disease and cone-rod dystrophy. More than 1,400 <i>ABCA4</i> missense variants have been identified; however, more than half of these remain variants of uncertain significance (VUS). The purpose of this study was to employ a predictive strategy to assess the pathogenicity of <i>ABCA4</i> variants in inherited retinal diseases using protein modeling and computational approaches.</p><p><strong>Methods: </strong>We studied 13 clinically well-defined patients with <i>ABCA4</i> retinopathies and identified the presence of 10 missense variants, including one novel variant in the <i>ABCA4</i> gene, by next-generation sequencing (NGS). All variants were structurally analyzed using AlphaFold2 models and existing experimental structures of human ABCA4 protein. The results of these analyses were compared with patient clinical presentations to test the effectiveness of the methods employed in predicting variant pathogenicity.</p><p><strong>Results: </strong>We conducted a phenotype-genotype comparison of 13 genetically and phenotypically well-defined retinal disease patients. The in silico protein structure analyses we employed successfully detected the deleterious effect of missense variants found in this affected patient cohort. Our study provides American College of Medical Genetics and Genomics (ACMG)-defined supporting evidence of the pathogenicity of nine missense <i>ABCA4</i> variants, aligning with the observed clinical phenotypes in this cohort.</p><p><strong>Conclusions: </strong>In this report, we describe a systematic approach to predicting the pathogenicity of <i>ABCA4</i> variants by means of three-dimensional (3D) protein modeling and in silico structure analysis. Our results demonstrate concordance between disease severity and structural changes in protein models induced by genetic variations. Furthermore, the present study suggests that in silico protein structure analysis can be used as a predictor of pathogenicity and may facilitate the assessment of genetic VUS.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"217-233"},"PeriodicalIF":2.2,"publicationDate":"2023-10-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784225/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466381","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Oxidative stress-induced temporal activation of ERK1/2 phosphorylates coreceptor of Wnt/β-catenin for myofibroblast formation in human lens epithelial cells.","authors":"Zaoxia Guo, Xiaopan Ma, Xi Chen, Rui Xue Zhang, Hong Yan","doi":"","DOIUrl":"","url":null,"abstract":"&lt;p&gt;&lt;strong&gt;Purpose: &lt;/strong&gt;Posterior capsular opacification (PCO) is the most common complication postcataract surgery, and its underlying mechanisms involve epithelial-mesenchymal transition (EMT) of remnant lens epithelial cells (LECs) in response to drastic changes in stimuli in the intraocular environment, such as oxidative stress and growth factors. Wnt/β-catenin signaling is a major pathway mediating oxidative stress-induced EMT in LECs, but its interplay with other transduction pathways remains little known in the development of PCO. ERK1/2 signaling is the downstream component of a phosphorelay pathway in response to extracellular stimuli (e.g., reactive oxygen species), and its activation regulates multiple cellular processes, including proliferation and EMT. Thus, this study aimed to investigate how ERK1/2 signaling and Wnt/β-catenin pathway crosstalk in oxidative stress-induced EMT in LECs.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Methods: &lt;/strong&gt;Hydrogen peroxide (H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt;) at 50 μM treatment for 48 h was used to establish a moderate oxidative stress-induced EMT model in LECs. ERK1/2 signaling was inhibited using MEK1/2 inhibitor U0126 at 20 μM. Western blotting was used to quantify protein expression of various biomarkers of EMT and phosphorylated components in ERK1/2 and Wnt/β-catenin signaling. LEC proliferation was determined using an EdU staining assay and expression of proliferating cellular nuclear antigen (PCNA). Subcellular localization of biomarker proteins was visualized with immunofluorescent staining.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Results: &lt;/strong&gt;Under the moderate level of H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt;-induced EMT in LECs, ERK1/2 signaling was activated, as evidenced by a marked increase in the ratio of phosphorylated ERK1/2 to total ERK1/2 at early (i.e., 5-15 min) and late time points (i.e., 12 h); the canonical Wnt/β-catenin pathway was activated by H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt; at 48 h. LECs exposed to H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt; exhibited hyperproliferation and EMT; however, these were restored by inhibition of ERK1/2 signaling demonstrated by reduced DNA synthesis and PCNA expression for cellular proliferation and altered expression of various EMT protein markers, including E-cadherin, α-SMA, and vimentin. More importantly, inhibition of ERK1/2 signaling reduced β-catenin accumulation in the activated Wnt/β-catenin signaling cascade. Specifically, there was significant downregulation in the phosphorylation level of LRP6 at Ser 1490 and GSK-3β at Ser 9, the key coreceptor of Wnt and regulator of β-catenin, respectively.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Conclusions: &lt;/strong&gt;ERK1/2 signaling plays a crucial role in the moderate level of oxidative stress-induced EMT in LECs. Pharmacologically blocking ERK1/2 signaling significantly inhibited LEC proliferation and EMT. Mechanistically, ERK1/2 signaling regulated Wnt/β-catenin cascade by phosphorylating Wnt coreceptor LRP6 at Ser 1490 in the plasma membrane. These results shed light on a potential molecular switch","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"206-216"},"PeriodicalIF":2.2,"publicationDate":"2023-10-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784218/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466374","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Addressing bias in manual segmentation of spheroid sprouting assays with U-Net.","authors":"Julian Rapp, Daniel Böhringer, Günther Schlunck, Hansjürgen Agostini, Thomas Reinhard, Felicitas Bucher","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Angiogenesis research faces the issue of false-positive findings due to the manual analysis pipelines involved in many assays. For example, the spheroid sprouting assay, one of the most prominent in vitro angiogenesis models, is commonly based on manual segmentation of sprouts. In this study, we propose a method for mitigating subconscious or fraudulent bias caused by manual segmentation. This approach involves training a U-Net model on manual segmentations and using the readout of this U-Net model instead of the potentially biased original segmentations. Our hypothesis is that U-Net will mitigate any bias in the manual segmentations because this will impose only random noise during model training. We assessed this idea using a simulation study.</p><p><strong>Methods: </strong>The training data comprised 1531 phase contrast images and manual segmentations from various spheroid sprouting assays. We randomly divided the images 1:1 into two groups: a fictitious intervention group and a control group. Bias was simulated exclusively in the intervention group. We simulated two adversarial scenarios: 1) removal of a single randomly selected sprout and 2) systematic shortening of all sprouts. For both scenarios, we compared the original segmentation, adversarial segmentation, and respective U-Net readouts. In the second step, we assessed the sensitivity of this approach to detect a true positive effect. We sampled multiple treatment and control groups with decreasing treatment effects based on unbiased ground truth segmentation.</p><p><strong>Results: </strong>This approach was able to mitigate bias in both adversarial scenarios. However, in both scenarios, U-Net detected the real treatment effects based on a comparison to the ground truth.</p><p><strong>Conclusions: </strong>This method may prove useful for verifying positive findings in angiogenesis experiments with a manual analysis pipeline when full investigator masking has been neglected or is not feasible.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"197-205"},"PeriodicalIF":2.2,"publicationDate":"2023-10-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784213/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466074","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Light damage induces inflammatory factors in mouse retina and vitreous humor.","authors":"Wei Liu, Xingfei Zhu, Xiangyu Ge, Yulin Chen, David Wan-Cheng Li, Lili Gong","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Increased inflammatory factor levels have been reported in the vitreous humor (VH) of diabetic retinopathy and neovascular age-related macular degeneration, ocular diseases generally associated with the formation of new retinal blood vessels and leakage. However, the levels of inflammatory mediators are less known in retinal degeneration without neovascularization. Human retinitis pigmentosa (RP) and animal models of light-induced retinal degeneration (LIRD) share several features, such as photoreceptor death and retinal inflammation. Here, we aimed to determine the levels of inflammatory factors in the VH of the LIRD mouse model.</p><p><strong>Methods: </strong>LIRD was induced by exposing BALB/c mice to white light (15,000 lx, 2 h), and the mice were recovered for 2 days before analysis (n = 50 mice). We assessed retinal morphology using optical coherence tomography and hematoxylin and eosin staining; retinal cell viability was determined using terminal deoxynucleotidyl transferase dUTP nick-end labeling, and retinal responses were measured based on electroretinogram signals. Total retinal RNAs were extracted and subjected to RNA sequencing analysis. VH samples from control (n = 4) and LIRD mice (n = 9) were assayed in triplicate for a panel of four inflammatory mediators using the Simple Plex Cartridge on an Ella System.</p><p><strong>Results: </strong>Retinal degeneration, photoreceptor death, infiltration of microglia/macrophages into the photoreceptor layer, and loss of a- and b-waves were obviously detected after LIRD. RNA sequencing revealed that light damage (LD) led to the significant upregulation of inflammatory factors in mouse retinas. In the VH, LD increased the total protein concentration. Dramatic induction of CCL2 (~3000 fold) and IL6 (~10 fold) was detected in VH in response to LD. Increased but not significant levels of TNFα and IL1β were also detected in light-exposed VH.</p><p><strong>Conclusions: </strong>Given that the LIRD model mimics RP pathogenesis in some aspects, these results suggest a causative link between retinal degeneration and VH inflammation in RP progression, and the increased CCL2 level in VH may reflect similar elevated CCL2 expression in the degenerative retina.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"180-187"},"PeriodicalIF":2.2,"publicationDate":"2023-10-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784230/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466222","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Timolol maleate, a β blocker eye drop, improved edema in a retinal vein occlusion model.","authors":"Shinichiro Fuma, Yae Hidaka, Anri Nishinaka, Hiroto Yasuda, Kota Aoshima, Shinsuke Nakamura, Hideaki Hara, Masamitsu Shimazawa","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>To investigate the therapeutic effects of eye drops, namely, timolol maleate, a β-adrenergic receptor antagonist, and latanoprost, a prostaglandin F2α analog, on retinal edema in a murine retinal vein occlusion (RVO) model.</p><p><strong>Methods: </strong>An RVO model was established using laser-induced RVO in mice, which were administered timolol maleate and latanoprost eye drops several times after venous occlusion. Subsequently, the thickness of the inner nuclear layer (INL) and the expression levels of such genes as <i>Vegf</i> and <i>Atf4</i>, which are stress markers of the endoplasmic reticulum, were examined. Primary human cultured retinal microvascular endothelial cells (HRMECs) were treated with timolol under hypoxic conditions, after which the gene expression pattern was investigated. Importantly, an integrated stress response inhibitor (ISRIB) was used in the RVO model, he known <i>ISRIB</i>, which suppresses the expression of <i>ATF4</i> in retinal edema.</p><p><strong>Results: </strong>Increased INL thickness was suppressed by timolol eye drops, as were the expressions of <i>Vegf</i> and <i>Atf4</i>, in the RVO model. However, latanoprost eye drops did not induce any change in INL thickness. In HRMECs, hypoxic stress and serum deprivation increased the <i>Vegf</i> and <i>Atf4</i> expressions; in response, treatment with timolol suppressed the <i>Vegf</i> expression. Furthermore, the ISRIB decreased the <i>Vegf</i> expression pattern and edema formation, which are associated with RVO.</p><p><strong>Conclusions: </strong>These results indicate that timolol eye drops may be a potential option for RVO treatment.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"188-196"},"PeriodicalIF":1.8,"publicationDate":"2023-10-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784217/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466548","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Identification and phenotypic analysis of novel LTBP2 mutations in a Chinese cohort with congenital ectopia lentis.","authors":"Liyan Liu, Dongwei Guo, Fengmei Yang, Haotian Qi, Yijing Zhou, Danying Zheng, Guangming Jin","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>To evaluate the frequency of LTBP2 mutations and to elaborate on LTBP2-related clinical phenotypes in a Chinese congenital ectopia lentis (CEL) cohort.</p><p><strong>Methods: </strong>In total, 145 Chinese probands with CEL were recruited for this study and underwent ocular and systemic examinations. Whole-exome sequencing was used to identify mutations, and Sanger sequencing and bioinformatics analysis were further performed to verify pathogenic mutations.</p><p><strong>Results: </strong>Overall, biallelic mutations in LTBP2 involving eight novel mutations (c.4370-7_4370-9delTCT, c.4370-5C>G, c.3452G>A, c.2253delG, c.4114T>C, c.1251G>A, c.4760G>A, and c.620G>A) were identified in four CEL probands (4/145, 2.76%). Patients with LTBP2 mutations were characterized by a megalocornea, spherophakia, high myopia, and glaucoma instead of a flat cornea, high corneal astigmatism, cardiovascular and skeletal abnormalities that were reported in other gene mutations. A novel homozygous frameshift mutation was detected, and this type of mutation was found to cause more complicated ocular symptoms than others, ranging from the anterior segment to the fundus.</p><p><strong>Conclusion: </strong>This study reported the mutation frequency of the LTBP2 gene in a Chinese CEL cohort and provided novel insight into LTBP2-related genotype-phenotype associations in CEL.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"169-179"},"PeriodicalIF":2.2,"publicationDate":"2023-10-10","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784221/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466103","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Downregulation of SIRT6 and NMNAT2 is associated with proliferative diabetic retinopathy.","authors":"Hui Chen, Xiongze Zhang, Nanying Liao, Yuying Ji, Lan Mi, Yuhong Gan, Yongyue Su, Feng Wen","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>To determine the expression levels of <i>SIRT6</i> and <i>NMNAT2</i> in diabetic retinopathy (DR).</p><p><strong>Methods: </strong>We obtained peripheral blood mononuclear cells (PBMCs) and vitreous samples from 77 patients with type 2 diabetes mellitus: 52 with DR and 25 without DR, and 27 healthy control subjects. Western blot analysis and qRT-PCR were performed to evaluate the expression of <i>SIRT6</i> and <i>NMNAT2</i> in their PBMCs. The levels of <i>IL-1β</i>, <i>IL-6</i>, and <i>TNF-α</i> in the vitreous fluid were determined by ELISA. Immunohistochemistry was performed to detect the expression of <i>SIRT6</i> and <i>NMNAT</i>2 in proliferative DR (PDR) and the control subjects.</p><p><strong>Results: </strong>The expression of <i>SIRT6</i> and <i>NMNAT2</i> was markedly downregulated in DR patients, which was negatively correlated with the increased expression of <i>IL-1β, IL-6</i> and <i>TNF-α</i>. Additionally, we observed decreased expression of <i>SIRT6</i> and <i>NMNAT2</i> in the fibrovascular membranes of PDR patients.</p><p><strong>Conclusions: </strong>The downregulated expression of <i>SIRT6</i> and <i>NMNAT2</i> in PDR patients reveals a potential pathogenic association; more extended studies could verify them as potential therapeutic targets.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"160-168"},"PeriodicalIF":2.2,"publicationDate":"2023-10-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784219/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466171","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"The Association between Cholesterol Levels and Severity of Normal Tension Glaucoma.","authors":"Yu-Chieh Wu, Chien-Chih Chou, Chun-Yuan Wang","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>To evaluate the serum lipid levels, including total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) of patients with normal tension glaucoma (NTG) and to investigate the relationship between serum HDL levels and the severity of NTG.</p><p><strong>Methods: </strong>In this cross-sectional, case-control study, 282 NTG subjects and 202 control subjects were enrolled from the outpatient clinic of the Department of Ophthalmology at Taichung Veterans General Hospital in central Taiwan from 2015 to 2021. Fasting cholesterol, HDL, and LDL levels were evaluated using a biochemical analyzer (ARCHITECT c16000). Glaucoma severity was classified by visual field test as mild (mean deviation [MD] ≥ -6.0dB), moderate (-12dB ≤ MD < -6 dB), and severe (MD < -12dB), based on the mean deviation.</p><p><strong>Results: </strong>HDL levels were significantly lower in the NTG group compared with the control subjects (47 ± 18mg/dl versus 53 ± 18mg/dl; p = 0.03). There were no statistically significant differences in total cholesterol or LDL levels between the NTG and control subjects (total cholesterol levels: 194 ± 39mg/dl versus 190 ± 32mg/dl; p > 0.05; LDL levels: 113 ± 30mg/dl versus 110 ± 29mg/dl; p > 0.05). The mean serum HDL levels were lowest in the severe group (41 ± 11mg/dl) followed by the moderate (45 ± 16mg/dl) and mild (50 ± 15mg/dl) groups, with significant differences among the three groups (p = 0.02). The multivariate regression analysis revealed a statistically significant negative correlation between HDL and vertical cup-to-disc ratio (VCDR; B =-0.16, p = 0.03) among all NTG patients and a positive correlation between HDL and retinal nerve fiber layer (RNFL; r = 0.34, p = 0.03) among all NTG patients.</p><p><strong>Conclusions: </strong>A significantly lower serum HDL concentration was found in the NTG patients, which was negatively associated with disease severity. The findings warrant further study to elucidate the role of these phenomena in the pathogenesis of glaucoma.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"153-159"},"PeriodicalIF":2.2,"publicationDate":"2023-09-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784211/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466457","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}