Journal of molecular graphics & modelling最新文献

{"title":"The binding of diruthenium (II,III) and dirhodium (II,II) paddlewheel complexes at DNA/RNA nucleobases: Computational evidences of an appreciable selectivity toward the AU base pairs","authors":"Iogann Tolbatov ,&nbsp;Paolo Umari ,&nbsp;Alessandro Marrone","doi":"10.1016/j.jmgm.2024.108806","DOIUrl":"10.1016/j.jmgm.2024.108806","url":null,"abstract":"<div><p>Multiple medicinal strategies involve modifications of the structure of DNA or RNA, which disrupt their correct functioning. Metal complexes with medicinal effects, also known as metallodrugs, are among the agents intended specifically for the attack onto nucleosides. The diruthenium (II,III) and dirhodium (II,II) paddlewheel complexes constitute promising dual acting drugs due to their ability to release the therapeutically active bridging ligands upon their substitution by endogenous ligands. In this paper, we study the structure and the stability of the complexes formed by the diruthenium (II,III) and dirhodium (II,II) paddlewheel complexes coordinated in axial positions with the DNA/RNA nucleobases or base pairs, assuming the attainable metalation at all the accessible pyridyl nitrogens. Dirhodium complexes coordinate at the pyridyl nitrogens more strongly than the diruthenium complexes. On the other hand, we found that the diruthenium scaffold binds more selectively to nucleobase targets. Furthermore, we reveal a tighter coordination of diruthenium complex at the adenine-uracil base pair, compared to adenine-thymine, hence constituting a scarce instance of RNA-selectivity. We envision that the here reported computational outcomes may pace future experiments addressing the binding of diruthenium and dirhodium paddlewheel complexes at either single nucleobases or DNA/RNA fragments.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.sciencedirect.com/science/article/pii/S1093326324001062/pdfft?md5=b8d31fab85c9aebf7546ea342dbc40f5&pid=1-s2.0-S1093326324001062-main.pdf","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141199119","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Combined experimental and computational investigation of tetrabutylammonium bromide-carboxylic acid-based deep eutectic solvents","authors":"Sahar Shokri,&nbsp;Nosaibah Ebrahimi,&nbsp;Rahmat Sadeghi","doi":"10.1016/j.jmgm.2024.108805","DOIUrl":"https://doi.org/10.1016/j.jmgm.2024.108805","url":null,"abstract":"<div><p>Aiming at shedding light on the molecular interactions in deep eutectic solvents (DESs), the DESs based on tetrabutylammonium bromide (TBAB) as hydrogen bond acceptor (HBA) and carboxylic acids (CAs) (formic acid (FA), oxalic acid (OA), and malonic acid (MA)) as hydrogen bond donor (HBD) were investigated by both experimental and theoretical techniques. The thermal behaviors of the prepared DESs were investigated by differential scanning calorimetry (DSC) method. In order to study the hydrogen bond formation between the DESs constituents, the FT-IR analysis was carried out. The large positive deviations of the iso solvent activity lines of ternary HBA + HBD + 2-propanol mixtures determined by the isopiestic technique from the semi-ideal behavior indicate that CAs interact strongly with TBAB and therefore they can form DESs. Molecular dynamics (MD) simulations were performed to present an atomic-scale image of the components and describe the microstructure of DESs. From the MD simulations, the radial distribution functions (RDFs), coordination numbers (CNs), combined distribution functions (CDFs), and spatial distribution functions (SDFs) were calculated to investigate the interaction between the components and three-dimensional visualization of the DESs. The obtained results confirmed the importance of hydrogen bonds in the formation of TBAB/CAs DESs.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141242867","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Utilization of the EpiMed Coronabank Chemical Collection to identify potential SARS-CoV-2 antivirals: in silico studies targeting the nsp14 ExoN domain and PLpro naphthalene binding site","authors":"Julia J. Liang ,&nbsp;Eleni Pitsillou ,&nbsp;Hannah L.Y. Lau ,&nbsp;Cian P. Mccubbery ,&nbsp;Hockxuen Gan ,&nbsp;Andrew Hung ,&nbsp;Tom C. Karagiannis","doi":"10.1016/j.jmgm.2024.108803","DOIUrl":"https://doi.org/10.1016/j.jmgm.2024.108803","url":null,"abstract":"<div><p>The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome encodes 29 proteins including four structural, 16 nonstructural (nsps), and nine accessory proteins (<span>https://epimedlab.org/sars-cov-2-proteome/</span><svg><path></path></svg>). Many of these proteins contain potential targetable sites for the development of antivirals. Despite the widespread use of vaccinations, the emergence of variants necessitates the investigation of new therapeutics and antivirals. Here, the EpiMed Coronabank Chemical Collection (<span>https://epimedlab.org/crl/</span><svg><path></path></svg>) was utilized to investigate potential antivirals against the nsp14 exoribonuclease (ExoN) domain. Molecular docking was performed to evaluate the binding characteristics of our chemical library against the nsp14 ExoN site. Based on the initial screen, trisjuglone, ararobinol, corilagin, and naphthofluorescein were identified as potential lead compounds. Molecular dynamics (MD) simulations were subsequently performed, with the results highlighting the stability of the lead compounds in the nsp14 ExoN site. Protein-RNA docking revealed the potential for the lead compounds to disrupt the interaction with RNA when bound to the ExoN site. Moreover, hypericin, cyanidin-3-O-glucoside, and rutin were previously identified as lead compounds targeting the papain-like protease (PL^pro) naphthalene binding site. Through performing MD simulations, the stability and interactions of lead compounds with PL^pro were further examined. Overall, given the critical role of the exonuclease activity of nsp14 in ensuring viral fidelity and the multifunctional role of PL^pro in viral pathobiology and replication, these nsps represent important targets for antiviral drug development. Our databases can be utilized for <em>in silico</em> studies, such as the ones performed here, and this approach can be applied to other potentially druggable SARS-CoV-2 protein targets.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.sciencedirect.com/science/article/pii/S1093326324001037/pdfft?md5=e210d9241884d3cecf0ed92a828f7a38&pid=1-s2.0-S1093326324001037-main.pdf","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141164060","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"NPEX: Never give up protein exploration with deep reinforcement learning","authors":"Yuta Shimono,&nbsp;Masataka Hakamada,&nbsp;Mamoru Mabuchi","doi":"10.1016/j.jmgm.2024.108802","DOIUrl":"https://doi.org/10.1016/j.jmgm.2024.108802","url":null,"abstract":"<div><p>Elucidating unknown structures of proteins, such as metastable states, is critical in designing therapeutic agents. Protein structure exploration has been performed using advanced computational methods, especially molecular dynamics and Markov chain Monte Carlo simulations, which require untenably long calculation times and prior structural knowledge. Here, we developed an innovative method for protein structure determination called never give up protein exploration (NPEX) with deep reinforcement learning. The NPEX method leverages the soft actor-critic algorithm and the intrinsic reward system, effectively adding a bias potential without the need for prior knowledge. To demonstrate the method's effectiveness, we applied it to four models: a double well, a triple well, the alanine dipeptide, and the tryptophan cage. Compared with Markov chain Monte Carlo simulations, NPEX had markedly greater sampling efficiency. The significantly enhanced computational efficiency and lack of prior domain knowledge requirements of the NPEX method will revolutionize protein structure exploration.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141250519","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Investigating the effect of welding tool length on mechanical strength of welded metallic matrix by molecular dynamics simulation","authors":"Xuejin Yang ,&nbsp;Rassol Hamed Rasheed ,&nbsp;Sami Abdulhak Saleh ,&nbsp;Mohammed Al-Bahrani ,&nbsp;C Manjunath ,&nbsp;Raman Kumar ,&nbsp;Soheil Salahshour ,&nbsp;Rozbeh Sabetvand","doi":"10.1016/j.jmgm.2024.108793","DOIUrl":"https://doi.org/10.1016/j.jmgm.2024.108793","url":null,"abstract":"<div><p>The welding process and the properties of welding instruments may improve the mechanical performance of an item. One of these properties is the length of the welding tool. This approach has a substantial effect on the mechanical strength of the metallic matrix. The current study used molecular dynamics modeling and LAMMPS software to evaluate the effect of welding tool length on the mechanical properties of a welded Cu–Ag metallic matrix. This simulation makes use of the Lennard-Jones potential function and the embedded atom model. First, the equilibrium phase of modeled samples was verified by changing the computation of kinetic and total energies. Next, the mechanical properties of the welded matrix were studied using the stated Young's modulus and ultimate strength. The stress-strain curve of samples demonstrated that the mechanical strength of atomic samples increased as the length of the welding tool (penetration depth) increased. Numerically, by increasing the tool penetration depth of Fe tools from 2 Å to 8 Å, Young's modulus and ultimate strength of the matrixes sample increase from 34.360 GPa to 1390.84 MPa to 38.44 GPa and 1510 MPa, respectively. This suggested that the length of the Fe welding tool significantly affected the mechanical properties of the welded metallic matrix. The longer the length of Fe welding tools, the more particles were involved, and consequently, more bonds were formed among the particles. Bonding among the particles caused changes in mechanical properties, such as greater ultimate strength. This method can optimize mechanical structures and be useful in various industries.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141097424","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"A theoretical investigation for improving the performance of non-fullerene organic solar cells through side-chain engineering of BTR non-fused-ring electron acceptors","authors":"Sidra Moeed ,&nbsp;R. Bousbih ,&nbsp;Ali Raza Ayub ,&nbsp;Nadhir N.A. Jafar ,&nbsp;Mohammed Aljohani ,&nbsp;Majid S. Jabir ,&nbsp;Mohammed A. Amin ,&nbsp;Hira Zubair ,&nbsp;Hasan Majdi ,&nbsp;Muhammad Waqas ,&nbsp;N.M.A. Hadia ,&nbsp;Rasheed Ahmad Khera","doi":"10.1016/j.jmgm.2024.108792","DOIUrl":"https://doi.org/10.1016/j.jmgm.2024.108792","url":null,"abstract":"<div><p>In the current quantum chemical study, indacenodithiophene donor core-based the end-capped alterations of the reference chromophore BTR drafted eight A2-A1-D-A1-A2 type small non-fullerene acceptors. All the computational simulations were executed under MPW1PW91/6-31G (d, p) level of DFT. The UV–Vis absorption, open circuit voltage, electron affinity, ionization potential, the density of states, reorganization energy, orbital analysis, and non-covalent interactions were studied and compared with BTR. Several molecules of our modeled series BT1-BT8 have shown distinctive features that are better than those of the BTR. The open circuit voltage (V_OC) of BT5 has a favorable impact, allowing it to replace BTR in the field of organic solar cells. The charge carrier motilities for proposed molecules generated extraordinary findings when matched to the reference one (BTR). Further charge transmission was confirmed by creating the complex with a PM6 donor molecule. The remarkable dipole moment contributes to the formation of non-covalent bond interactions with chloroform, resulting in superior charge mobility. Based on these findings, it can be said that every tailored molecule has the potential to surpass chromophore molecule (BTR) in OSCs. So, all tailored molecules may enhance the efficiency of photovoltaic cells due to the involvement of potent terminal electron-capturing acceptor2 moieties. Considering these obtained results, these newly presented molecules can be regarded for developing efficient solar devices in the future.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141096178","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Theoretical design of alkaline earthides M+(36 adz) Be− (M+ = V, Cr, Mn, Fe, Co, Ni, Cu, and Zn) with excellent nonlinear optical response and ultraviolet transparency","authors":"Jabir Hussain ,&nbsp;Riaz Hussain ,&nbsp;Ajaz Hussain ,&nbsp;Mirza Arfan Yawer ,&nbsp;Muhammad Arshad ,&nbsp;Saleh S. Alarfaji ,&nbsp;Abdul Rauf ,&nbsp;Khurshid Ayub","doi":"10.1016/j.jmgm.2024.108791","DOIUrl":"https://doi.org/10.1016/j.jmgm.2024.108791","url":null,"abstract":"<div><p>A novel series of alkaline earthides containing eight complexes based upon 3⁶adz complexant are designed by placing carefully transition metals (V–Zn) on inner side and alkaline earth metal outer side of the complexant <em>i.e.,</em> M⁺(3⁶adz) Be⁻ (M⁺ = V, Cr, Mn, Fe, Co, Ni, Cu and Zn). All the designed compounds are electronically and thermodynamically stable as evaluated by their interaction energy and vertical ionization potential respectively. Moreover, the true nature of alkaline earthides is verified through NBOs and FMO study, showing negative charge and excess electrons on alkaline earth metal respectively. Furthermore, true alkaline earthides characteristics are evaluated graphically by spectra of partial density state (PDOS). The energy gap (HOMO -LUMO gap) is very small (ranging 2.95 eV–1.89 eV), when it is compared with pure cage 3⁶adz HOMO-LUMO gap <em>i.e.,</em> 8.50 eV. All the complexes show a very small value of transition energy ranging from 1.68eV to 0.89eV. Also, these possess higher hyper polarizability values up to 2.8 x 10⁵au (for Co⁺(3⁶adz) Be⁻). Furthermore, an increase in hyper polarizability was observed by applying external electric field on complexes. The remarkable increase of 100fold in hyper polarizability of Zn⁺(3⁶adz) Be⁻ complex is determined after application of external electric field <em>i.e.,</em> from 1.7 x 10⁴ au to 1.7 x 10⁶ au when complex is subjected to external electric field of 0.001 au strength. So, when external electric field is applied on complexes it enhances the charge transfer, polarizability and hyper polarizability of complexes and proves to be effective for designing of true alkaline earthides with remarkable NLO response.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-19","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141073411","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Corrigendum to “Structural and functional analysis of Cyanovirin-N homologs: Carbohydrate binding affinities and antiviral potential of cyanobacterial peptides” [J. Mol. Graph. Model. 129 (June 2024), 108718]","authors":"Gabriel Albuquerque Xavier,&nbsp;Alenna Sousa,&nbsp;Larissa Queiroz dos Santos,&nbsp;Délia Cristina Figueira Aguiar,&nbsp;Evonnildo Costa Gonçalves,&nbsp;Andrei Santos Siqueira","doi":"10.1016/j.jmgm.2024.108788","DOIUrl":"10.1016/j.jmgm.2024.108788","url":null,"abstract":"","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-10","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.sciencedirect.com/science/article/pii/S1093326324000883/pdfft?md5=23df138ec140ae04ec1285eef9f0f727&pid=1-s2.0-S1093326324000883-main.pdf","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"140904622","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First-principles calculation on electronic properties of hydrogen evolution reaction of Ni-based electrode surfaces with different monatomic doping","authors":"Jianping Zeng ,&nbsp;Yan Zhang ,&nbsp;Shuyu Zeng ,&nbsp;Jingwen Li ,&nbsp;Yuchen Fang ,&nbsp;Ling Qian ,&nbsp;Luobu Pubu ,&nbsp;Song Chen","doi":"10.1016/j.jmgm.2024.108790","DOIUrl":"10.1016/j.jmgm.2024.108790","url":null,"abstract":"<div><p>At present, the hydrogen evolution reaction (HER) of Ni-based electrode has an important influence on water electrolysis hydrogen production technology, involving complex electrochemical process of electrode. In this project, Materials Studio (MS) software was used to design and construct Ni-based electrode surface (NES) models with monatomic Mo, Co, Fe, Cr doping, and the NES models attached 1 H atom and 2H atoms were denoted as the NES-H models and NES-2H model, respectively. Then the first-principles calculation was carried out.</p><p>The results showed that the doping of different atoms can effectively change the work function of the pure Ni. In the charge transfer process of the four NES-2H models, the distance between the two H atoms is most affected by Mo doping, and they leave the Ni electrode surface as a single H ion, respectively, while the effect on Co, Fe and Cr doping is relatively consistent, and they leave the Ni electrode surface with H₂ molecules, respectively. The doping of four single atoms changes the distance of valence band (VB) top and conduction band (CB) bottom from Fermi level in NES, NES-H and NES-2H models, and affects the HER, in which Mo doping has the greatest effect. The TDOS of the above models is mainly derived from the PDOS of the d orbitals of the doped atoms and Ni atoms. The results will provide a theoretical basis for the research and development of Ni-based electrode materials in HER.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-10","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"140945302","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor","authors":"Misgana Mengistu Asmare ,&nbsp;Chandran Krishnaraj ,&nbsp;Sivaprakasam Radhakrishnan ,&nbsp;Byoung-Sukh Kim ,&nbsp;June-Sun Yoon ,&nbsp;Soon-Il Yun","doi":"10.1016/j.jmgm.2024.108787","DOIUrl":"https://doi.org/10.1016/j.jmgm.2024.108787","url":null,"abstract":"<div><p>Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10⁻⁹ – 200 × 10⁻⁹ M), detection limit (1.0 × 10⁻⁹ M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.</p></div>","PeriodicalId":16361,"journal":{"name":"Journal of molecular graphics & modelling","volume":null,"pages":null},"PeriodicalIF":2.9,"publicationDate":"2024-05-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"140917915","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}