Genome BiologyPub Date : 2025-03-28DOI: 10.1186/s13059-025-03533-6
Devlin C. Moyer, Justin Reimertz, Daniel Segrè, Juan I. Fuxman Bass
{"title":"MACAW: a method for semi-automatic detection of errors in genome-scale metabolic models","authors":"Devlin C. Moyer, Justin Reimertz, Daniel Segrè, Juan I. Fuxman Bass","doi":"10.1186/s13059-025-03533-6","DOIUrl":"https://doi.org/10.1186/s13059-025-03533-6","url":null,"abstract":"Genome-scale metabolic models (GSMMs) are used to predict metabolic fluxes, with applications ranging from identifying novel drug targets to engineering microbial metabolism. Erroneous or missing reactions, scattered throughout densely interconnected networks, are a limiting factor in these applications. We present Metabolic Accuracy Check and Analysis Workflow (MACAW), a suite of algorithms that helps to identify and visualize errors at the level of connected pathways, rather than individual reactions. We show how MACAW highlights inaccuracies of varying severity in manually curated and automatically generated GSMMs for humans, yeast, and bacteria and helps to identify systematic issues to be addressed in future model construction efforts.\u0000","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"23 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143723335","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"DEMINERS enables clinical metagenomics and comparative transcriptomic analysis by increasing throughput and accuracy of nanopore direct RNA sequencing","authors":"Junwei Song, Li-an Lin, Chao Tang, Chuan Chen, Qingxin Yang, Dan Zhang, Yuancun Zhao, Han-cheng Wei, Kepan Linghu, Zijie Xu, Tingfeng Chen, Zhifeng He, Defu Liu, Yu Zhong, Weizhen Zhu, Wanqin Zeng, Li Chen, Guiqin Song, Mutian Chen, Juan Jiang, Juan Zhou, Jing Wang, Bojiang Chen, Binwu Ying, Yuan Wang, Jia Geng, Jing-wen Lin, Lu Chen","doi":"10.1186/s13059-025-03536-3","DOIUrl":"https://doi.org/10.1186/s13059-025-03536-3","url":null,"abstract":"Nanopore direct RNA sequencing (DRS) is a powerful tool for RNA biology but suffers from low basecalling accuracy, low throughput, and high input requirements. We present DEMINERS, a novel DRS toolkit combining an RNA multiplexing workflow, a Random Forest-based barcode classifier, and an optimized convolutional neural network basecaller with species-specific training. DEMINERS enables accurate demultiplexing of up to 24 samples, reducing RNA input and runtime. Applications include clinical metagenomics, cancer transcriptomics, and parallel transcriptomic comparisons, uncovering microbial diversity in COVID-19 and m6A’s role in malaria and glioma. DEMINERS offers a robust, high-throughput solution for precise transcript and RNA modification analysis.\u0000","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"49 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143723338","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Pamoic acid and carbenoxolone specifically inhibit CRISPR/Cas9 in bacteria, mammalian cells, and mice in a DNA topology-specific manner","authors":"Yuxuan Zhang, Wentao Zou, Yueyang Zhou, Jiaqi Chen, Youtian Hu, Fang Wu","doi":"10.1186/s13059-025-03521-w","DOIUrl":"https://doi.org/10.1186/s13059-025-03521-w","url":null,"abstract":"Regulation of the target DNA cleavage activity of CRISPR/Cas has naturally evolved in a few bacteria or bacteriophages but is lacking in higher species. Thus, identification of bioactive agents and mechanisms that can suppress the activity of Cas9 is urgently needed to rebalance this new genetic pressure. Here, we identify four specific inhibitors of Cas9 by screening 4607 compounds that could inhibit the endonuclease activity of Cas9 via three distinct mechanisms: substrate-competitive and protospacer adjacent motif (PAM)-binding site-occupation; substrate-targeting; and sgRNA-targeting mechanisms. These inhibitors inhibit, in a dose-dependent manner, the activity of Streptococcus pyogenes Cas9 (SpyCas9), Staphylococcus aureus Cas9 (SauCas9), and SpyCas9 nickase-based BE4 base editors in in vitro purified enzyme assays, bacteria, mammalian cells, and mice. Importantly, pamoic acid and carbenoxolone show DNA-topology selectivity and preferentially inhibit the cleavage of linear DNA compared with a supercoiled plasmid. These pharmacologically selective inhibitors and new mechanisms offer new tools for controlling the DNA-topology selective activity of Cas9.","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"33 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143723339","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Genome BiologyPub Date : 2025-03-26DOI: 10.1186/s13059-025-03547-0
Qinwei Kim-Wee Zhuang, Klara Bauermeister, Jose Hector Galvez, Najla Alogayil, Enkhjin Batdorj, Fernando Pardo Manuel de Villena, Teruko Taketo, Guillaume Bourque, Anna K. Naumova
{"title":"Survey of gene, lncRNA and transposon transcription patterns in four mouse organs highlights shared and organ-specific sex-biased regulation","authors":"Qinwei Kim-Wee Zhuang, Klara Bauermeister, Jose Hector Galvez, Najla Alogayil, Enkhjin Batdorj, Fernando Pardo Manuel de Villena, Teruko Taketo, Guillaume Bourque, Anna K. Naumova","doi":"10.1186/s13059-025-03547-0","DOIUrl":"https://doi.org/10.1186/s13059-025-03547-0","url":null,"abstract":"Sex-biased gene regulation is the basis of sexual dimorphism in phenotypes and has been studied across different cell types and different developmental stages. However, sex-biased expression of transposable elements (TEs), which represent nearly half of the mammalian genome and have the potential of influencing genome integrity and regulation, remains underexplored. We report a survey of gene, lncRNA, and TE expression in four organs from mice with different combinations of gonadal and genetic sex. The data show remarkable variability among organs with respect to the impact of gonadal sex on transcription with the strongest effects observed in the liver. In contrast, the X-chromosome dosage alone had a modest influence on sex-biased transcription across organs, albeit interaction between X-dosage and gonadal sex cannot be ruled out. The presence of the Y-chromosome influences TE, but not gene or lncRNA, expression in the liver. Notably, 90% of sex-biased TEs (sDETEs) reside in clusters. Moreover, 54% of these clusters overlap or reside less than 100 kb from sex-biased genes or lncRNAs, share the same sex bias, and also have higher expression levels than sDETE clusters that do not co-localize with other types of sex-biased transcripts. We test the heterochromatic sink hypothesis that predicts higher expression of TEs in XX individuals finding no evidence to support it. Our data show that sex-biased expression of TEs varies among organs with the highest numbers of sDETEs found in the liver following trends observed for genes and lncRNAs. It is enhanced by proximity to other types of sex-biased transcripts.\u0000","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"72 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143713071","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Genome BiologyPub Date : 2025-03-26DOI: 10.1186/s13059-025-03540-7
Xin Wang, Kun Wang, Weixing Zhang, Zhongjie Tang, Hao Zhang, Yuying Cheng, Da Zhou, Chao Zhang, Wen-Zhao Zhong, Qing Ma, Jin Xu, Zheng Hu
{"title":"Clonal expansion dictates the efficacy of mitochondrial lineage tracing in single cells","authors":"Xin Wang, Kun Wang, Weixing Zhang, Zhongjie Tang, Hao Zhang, Yuying Cheng, Da Zhou, Chao Zhang, Wen-Zhao Zhong, Qing Ma, Jin Xu, Zheng Hu","doi":"10.1186/s13059-025-03540-7","DOIUrl":"https://doi.org/10.1186/s13059-025-03540-7","url":null,"abstract":"Mitochondrial DNA (mtDNA) variants hold promise as endogenous barcodes for tracking human cell lineages, but their efficacy as reliable lineage markers are hindered by the complex dynamics of mtDNA in somatic tissues. Here, we use computational modeling and single-cell genomics to thoroughly interrogate the origin and clonal dynamics of mtDNA variants across various biological settings. Our findings reveal that the majority of mtDNA variants which are specifically present in a cell subpopulation, termed subpopulation-specific variants, are pre-existing heteroplasmies in the first cell instead of de novo somatic mutations during divisions. Moreover, subpopulation-specific variants demonstrate limited discriminatory power among different genuine lineages under weak clonal expansion; however, certain subpopulation-specific variants with consistently high frequencies among a subpopulation are capable of faithfully labeling cell lineages in scenarios of stringent clonal expansion, such as strongly expanded T cell populations in diseased conditions and clonal hematopoiesis in aged individuals. Inspired by our simulations, we introduce a lineage informative score, facilitating the identification of reliable mitochondrial lineage tracing markers across different modalities of single-cell genomic data. Combining computational modeling and single-cell sequencing, our study reveals that the performance of mitochondrial lineage tracing is highly dependent on the extent of clonal expansion, which thus should be considered when applying mitochondrial lineage tracing.","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"4 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143702865","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Genome BiologyPub Date : 2025-03-26DOI: 10.1186/s13059-025-03522-9
Sojung Lee, Jayne A. Barbour, Yee Man Tam, Haocheng Yang, Yuanhua Huang, Jason W. H. Wong
{"title":"LocusMasterTE: integrating long-read RNA sequencing improves locus-specific quantification of transposable element expression","authors":"Sojung Lee, Jayne A. Barbour, Yee Man Tam, Haocheng Yang, Yuanhua Huang, Jason W. H. Wong","doi":"10.1186/s13059-025-03522-9","DOIUrl":"https://doi.org/10.1186/s13059-025-03522-9","url":null,"abstract":"Transposable elements (TEs) can influence human diseases by disrupting genome integrity, yet their quantification has been challenging due to the repetitive nature of these sequences across the genome. We develop LocusMasterTE, a method that integrates long-read with short-read RNA-seq to increase the accuracy of TE expression quantification. By incorporating fractional transcript per million values from long-read sequencing data into an expectation–maximization algorithm, LocusMasterTE reassigns multi-mapped reads, enhancing accuracy in short-read-based TE quantification. We validate the method with simulated and human datasets. LocusMasterTE may give new insights into TE functions through precise quantification.","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"21 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143702863","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Genome BiologyPub Date : 2025-03-26DOI: 10.1186/s13059-025-03548-z
Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Axel Pruß, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke, Dimitrios L. Wagner
{"title":"Author Correction: Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells","authors":"Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Axel Pruß, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke, Dimitrios L. Wagner","doi":"10.1186/s13059-025-03548-z","DOIUrl":"https://doi.org/10.1186/s13059-025-03548-z","url":null,"abstract":"<p><b>Correction: Genome Biol 24, 89 (2023)</b></p><p><b>https://doi.org/10.1186/s13059-023–02928-7</b></p><br/><p>Following publication of the original article [1], the authors identified an error in one of the guide RNA spacer sequences disclosed in Supplementary Table S3. The correct sequence for base editing mediated silencing of the <i>CIITA</i> is 5’−3’: CACTCACCTTAGCCTGAGCA, as originally described in Gaudelli et al. 2020 [2].</p><p>This error does not affect the main results and conclusions of the paper.</p><p>The Supplementary Table S3 of the original article [1] has been corrected.</p><ol data-track-component=\"outbound reference\" data-track-context=\"references section\"><li data-counter=\"1\"><p>Glaser V, Flugel C, Kath J, et al. Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells. Genome Biol. 2023;24:89. https://doi.org/10.1186/s13059-023-02928-7.</p><p>Article CAS PubMed PubMed Central Google Scholar </p></li><li data-counter=\"2\"><p>Gaudelli NM, Lam DK, Rees H, et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol. 2020;38:7. https://doi.org/10.1038/s41587-020-0491-6.</p><p>Article CAS Google Scholar </p></li></ol><p>Download references<svg aria-hidden=\"true\" focusable=\"false\" height=\"16\" role=\"img\" width=\"16\"><use xlink:href=\"#icon-eds-i-download-medium\" xmlns:xlink=\"http://www.w3.org/1999/xlink\"></use></svg></p><h3>Authors and Affiliations</h3><ol><li><p>Berlin Center for Advanced Therapies (Becat), Charité – Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität Zu Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany</p><p>Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke & Dimitrios L. Wagner</p></li><li><p>BIH Center for Regenerative Therapies (BCRT), Berlin Institute of Health at Charité – Universitätsmedizin Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany</p><p>Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke & Dimitrios L. Wagner</p></li><li><p>Institute of Transfusion Medicine, Charité – Universitätsmedizin Berlin, corporate member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Campus Charité Mitte, Charitéplatz 1, Berlin, 10117, Germany</p><p>Axel Pruß & Dimitrios L. Wagner</p></li><li><p>Institute of Medical Immunology, Charité – Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität Zu Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany</p><p>Hans-Dieter Volk & Dimitrios L. Wagner</p></li><li><p>CheckImmune GmbH, Campus Virchow Klinikum, Augustenburger Platz ","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"183 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143702866","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Genome BiologyPub Date : 2025-03-26DOI: 10.1186/s13059-025-03539-0
Sophie A. Montandon, Pierre Beaudier, Asier Ullate-Agote, Pierre-Yves Helleboid, Maya Kummrow, Sergi Roig-Puiggros, Denis Jabaudon, Leif Andersson, Michel C. Milinkovitch, Athanasia C. Tzika
{"title":"Regulatory and disruptive variants in the CLCN2 gene are associated with modified skin color pattern phenotypes in the corn snake","authors":"Sophie A. Montandon, Pierre Beaudier, Asier Ullate-Agote, Pierre-Yves Helleboid, Maya Kummrow, Sergi Roig-Puiggros, Denis Jabaudon, Leif Andersson, Michel C. Milinkovitch, Athanasia C. Tzika","doi":"10.1186/s13059-025-03539-0","DOIUrl":"https://doi.org/10.1186/s13059-025-03539-0","url":null,"abstract":"Snakes exhibit a broad variety of adaptive colors and color patterns, generated by the spatial arrangement of chromatophores, but little is known of the mechanisms responsible for these spectacular traits. Here, we investigate a mono-locus trait with two recessive alleles, motley and stripe, that both cause pattern aberrations in the corn snake. We use mapping-by-sequencing to identify the genomic interval where the causal mutations reside. With our differential gene expression analyses, we find that CLCN2 (Chloride Voltage-Gated Channel 2), a gene within the genomic interval, is significantly downregulated in Motley embryonic skin. Furthermore, we identify the stripe allele as the insertion of an LTR-retrotransposon in CLCN2, resulting in a disruptive mutation of the protein. We confirm the involvement of CLCN2 in color pattern formation by producing knock-out snakes that present a phenotype similar to Stripe. In humans and mice, disruption of CLCN2 results in leukoencephalopathy, as well as retinal and testes degeneration. Our single-cell transcriptomic analyses in snakes reveal that CLCN2 is indeed expressed in chromatophores during embryogenesis and in the adult brain, but the behavior and fertility of Motley and Stripe corn snakes are not impacted. Our genomic, transcriptomic, and functional analyses identify a plasma membrane anion channel to be involved in color pattern development in snakes and show that an active LTR-retrotransposon might be a key driver of trait diversification in corn snakes.\u0000","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"124 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143702864","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Genome BiologyPub Date : 2025-03-24DOI: 10.1186/s13059-025-03537-2
Sofia Rucli, Nicolas Descostes, Yulia Ermakova, Urvashi Chitnavis, Jeanne Couturier, Ana Boskovic, Matthieu Boulard
{"title":"Functional genomic profiling of O-GlcNAc reveals its context-specific interplay with RNA polymerase II","authors":"Sofia Rucli, Nicolas Descostes, Yulia Ermakova, Urvashi Chitnavis, Jeanne Couturier, Ana Boskovic, Matthieu Boulard","doi":"10.1186/s13059-025-03537-2","DOIUrl":"https://doi.org/10.1186/s13059-025-03537-2","url":null,"abstract":"How reversible glycosylation of DNA-bound proteins acts on transcription remains scarcely understood. O-linked β-N-acetylglucosamine (O-GlcNAc) is the only known form of glycosylation modifying nuclear proteins, including RNA polymerase II (RNA Pol II) and many transcription factors. Yet, the regulatory function of the O-GlcNAc modification in mammalian chromatin remains unclear. Here, we combine genome-wide profiling of O-GlcNAc-modified proteins with perturbations of intracellular glycosylation, RNA Pol II-degron, and super-resolution microscopy. Genomic profiling of O-GlcNAc-modified proteins shows a non-random distribution across the genome, with high densities in heterochromatin regions as well as on actively transcribed gene promoters. Large-scale intersection of the O-GlcNAc signal at promoters with public ChIP-seq datasets identifies a high overlap with RNA Pol II and specific cofactors. Knockdown of O-GlcNAc Transferase (Ogt) shows that most direct target genes are downregulated, supporting a global positive role of O-GlcNAc on the transcription of cellular genes. Rapid degradation of RNA Pol II results in the decrease of the O-GlcNAc levels at promoters encoding transcription factors and DNA modifying enzymes. RNA Pol II depletion also unexpectedly causes an increase of O-GlcNAc levels at a set of promoters encoding for the transcription machinery. This study provides a deconvoluted genomic profiling of O-GlcNAc-modified proteins in murine and human cells. Perturbations of O-GlcNAc or RNA Pol II uncover a context-specific reciprocal functional interplay between the transcription machinery and the O-GlcNAc modification.","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"17 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-24","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143678080","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Dissecting the genetic architecture of key agronomic traits in lettuce using a MAGIC population","authors":"Hongyun Chen, Jiongjiong Chen, Ruifang Zhai, Dean Lavelle, Yue Jia, Qiwei Tang, Ting Zhu, Menglu Wang, Zedong Geng, Jianzhong Zhu, Hui Feng, Junru An, Jiansheng Liu, Weibo Li, Shenzhao Deng, Wandi Wang, Weiyi Zhang, Xiaoyan Zhang, Guangbao Luo, Xin Wang, Sunil Kumar Sahu, Huan Liu, Richard Michelmore, Wanneng Yang, Tong Wei, Hanhui Kuang","doi":"10.1186/s13059-025-03541-6","DOIUrl":"https://doi.org/10.1186/s13059-025-03541-6","url":null,"abstract":"Lettuce is a globally important leafy vegetable that exhibits diverse horticultural types and strong population structure, which complicates genetic analyses. To address this challenge, we develop the first multi-parent, advanced generation inter-cross (MAGIC) population for lettuce using 16 diverse founder lines. Whole-genome sequencing of the 16 founder lines and 381 inbred progeny reveal minimal population structure, enabling informative genome-wide association studies (GWAS). GWAS of the lettuce MAGIC population identifies numerous loci associated with key agricultural traits, including 51 for flowering time, 11 for leaf color, and 5 for leaf shape. Notably, loss-of-function mutations in the LsphyB and LsphyC genes, encoding phytochromes B and C, dramatically delay flowering in lettuce, which is in striking contrast to many other plant species. This unexpected finding highlights the unique genetic architecture controlling flowering time in lettuce. The wild-type LsTCP4 gene plays critical roles in leaf flatness and its expression level is negatively correlated with leaf curvature. Additionally, a novel zinc finger protein (ZFP) gene is required for the development of lobed leaves; a point mutation leads to its loss of function and consequently converted lobed leaves to non-lobed leaves, as exhibited by most lettuce cultivars. The MAGIC population’s lack of structure and high mapping resolution enables the efficient dissection of complex traits. The identified loci and candidate genes provide significant genetic resources for improving agronomic performance and leaf quality in lettuce.\u0000","PeriodicalId":12611,"journal":{"name":"Genome Biology","volume":"34 1","pages":""},"PeriodicalIF":12.3,"publicationDate":"2025-03-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143675204","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":1,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}