{"title":"SEED PRODUCTIVITY OF EASTERN GALEGA IN THE CONDITIONS OF THE MIDDLE VOLGA REGION","authors":"N. V. Safina","doi":"10.18286/1816-4501-2022-3-43-47","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-43-47","url":null,"abstract":"In order to obtain seed material of perennial grasses in the second year of herbage life, it is necessary to create favorable conditions and rationally use the arable land in the sowing year. Single-cropsand mixed crops of Eastern galega were studied in the middle zone of the Volga region, the accompanying crop, hereinafter referred to as cover crop, was corn, harvested in the year of sowing from this area as green feed, and at a later date - for silage. Appropriate doses of fertilizers, under the influence of which the plants of corn and Eastern galega increased their productive qualities were also established. The experiment was carried out in grain-grass crop rotation on the fields of Ulyanovsk Research Institute of Agriculture. The crops of Eastern galega of the second and third years of life were compared:how they were affected by the conditions created in the year of sowing, namely, development of plants under the cover of corn harvested at different times for green feed and silage compared to single-crop sowing (control) and doses of fertilizers applied before sowing: unfertilized background (control), N15Р15K15 , N30P30K30. Thus, survivability of Eastern galega plants, before wintering, was greater for crops under the cover of corn, which was harvested at an earlier date, with a dose of applied fertilizers N15P15K15 (on average 60-98%). Growing conditions in this variant were more comfortable for plants of Eastern galega in the year of sowing, seed yield in the second and third years of grass stand life was higher - 3.5 c/ha in 2012 and 3.9 c/ha in 2013. Cover corn crop was obtained from the area in the year of sowing. The higher the dose of fertilizers, the greater the yield of green mass: for N30P30K30 - 40.4 t/ha of corn harvested for green feed and 48.0 t/ha harvested for silage.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"144 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"73468804","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"DNA ISOLATION FROM BIOLOGICAL MATERIAL OF MARALS","authors":"M. Lubennikova, K. A. Afanasiev, V. A. Afanasiev","doi":"10.18286/1816-4501-2022-3-181-185","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-181-185","url":null,"abstract":"The main task of maral breeding isproduction increase of antlers. Application of molecular genetic methods in maral breeding contributes to increase in reliability and accuracy of assessment of productivity and breeding value of stag deer at an early age. The purpose of the research is to test methods DNA isolation from biological material of marals. The biomaterial was selected fromstag deer of Altai-Sayan breed (blood, antler crumbs, cartilaginous tissue of the auricles). The work on DNA isolation from maral tissue samples was carried out in the bioengineering laboratory at Altai State University (Barnaul). DNA isolation was conducted using the method based on application of Chelex-100TM Resin chelating agent (Bio-Rad, USA), the method based on DNA precipitation Diamond DNA (OOO ABT, Russia) and commercial kit based on magnetic particles AMPure XP (Beckman Coulter, USA). The purification degree of the isolated DNA was assessed by PCR efficiency in reactions of amplification of the genes of cytochrome oxidase 1, cytochrome B of mitochondrial DNA. The highest concentration of maral DNA was established in isolation based on DNA precipitation (Diamond DNA). The concentration of DNA in the solution was 13.20 ng/µl (blood), 11.30 ng/µl (cartilaginous tissue), 5.74 ng/µl (antler crumbs).","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"85 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"85986407","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"INFLUENCE OF FOLIAR MINERAL NUTRITION ON BIOMETRIC PARAMETERS OF HOME PLUM VARIETIES IN HYPERARID CONDITIONS OF THE NORTHERN CASPIAN REGION","authors":"T. Aleksandrova","doi":"10.18286/1816-4501-2022-3-58-63","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-58-63","url":null,"abstract":"An important factor of horticulture intensification in all areas of fruit crops is a balanced mineral nutrition, which includes both introduction of main elements of nitrogen, phosphorus and potassium, and foliar dressing with macro- and microelements. This is especially vital for plums which is characterized by a high removal of nutrients, particularly, potassium and calcium. The article presents results of the influence of foliar mineral nutrition on home plum varieties to justify for usageon light chestnut soils in the Northern Caspian region under arid conditions. The purpose of the research was to study the effect of foliar dressing with macro- and microfertilizers on biometric parameters (increase ofbole circumference, extension shoots, seed-bud preservation) of plum varieties on light chestnut soils of Astrakhan region. The study was carried out at the experimental site of Federal State Budgetary Scientific Institution \"Caspian Agrarian Federal Scientific Center of the Russian Academy of Sciences\". The experimental plot was laid in 2014. Records and observations were carried out in 2019-2021. The research material includedBogatyrskaya, Volgogradskaya, Zainap plum varieties and foliar feeding with Master 18:18:18, Aquarin, Ultramag boron and Ultramag calcium. As a result of the research, it was found that intensification of vital processes of plants can be traced by increase of the bole circumference, the length of annual shoots, seed-bud preservation, which ultimately has a positive effect on yieldincrease. As far as foliar dressing in various phases of plumdevelopment is concerned, top dressing with Aquarinin combination with Ultramag boron and Ultramag calcium is the most effective.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"18 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84085020","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"INFLUENCE OF FORECROPS AND SUPPLEMENTARY FERTILIZATION OF WINTER WHEAT AT DIFFERENT PERIODS OF ITS VEGETATION ON YIELD FORMATION AND GRAIN QUALITY","authors":"R. Khakimov, N. Khakimova","doi":"10.18286/1816-4501-2022-3-48-57","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-48-57","url":null,"abstract":"Research on the study of effectiveness of nitrogen fertilization on productivity and quality of winter wheat grain was conducted in the conditions of the Volga region in 2017-2021. A two-factor experiment was set on leached heavy loamy black soil (humus - 6.5% by Tyurin; pH of the salt extract - 6.3-6.5; P2O5 - 185-216; K2O - 80-85 mg per 1 kg of soil) according to the following scheme: I - forecrop (factor A): complete and sown fallow; II. fertilization with ammonium nitrate (factor B): 1. control (N0); 2. autumn (N34); 3 with a seeder (N34); 4. early spring (N34); 5 early spring (N34) + at the shooting stage (N34); 6 early spring (N34) + at the shooting stage (N34) + N15at the heading phase. Lack of moisture at the start of the experiments did not allow to obtain friendly seedlings (complete fallow - 75.9-78.3%, sown - 71.7-75.2%). Frequent temperature fluctuations at the beginning of the vegetation season and lack of precipitation during the period of grain filling had a negative impact on survivability of plants by the harvesting time (complete fallow - 44.9-50.3%, sown - 29.2-34.2%). The highest grain yield (4.48 t/ha) was formed when winter wheat was sown on complete fallow in combination with fertilizer application (N34+N34+N15), which exceeded the control by 1.11 t/ha (34.9%). High content of protein (13.7%) and gluten (31.8%) provided the variant with early spring fertilization in a scattered way at a dose of N34. An increase offertilization frequency led to a decrease of protein (13.3%) and gluten (30.4%). Cultivation of winter wheat on sown fallow reduced yield by 1.19 t/ha (36.2%) and quality parametres (protein 12.2%, gluten 26.9%) of the grain. The highest net operating profit (25,883 rubles/ha) and high profitability (136.8%) of the grain were obtained when sown on complete fallow in combination with fractional fertilization at different stages of plant development. The cost of 1 ton of grain was 4220 rubles.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"21 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84250707","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"USAGE OF ORGANIC SURFACE ACTIVE AGENT AS ANTI-WEAR ADDITIVES TO DIESEL FUEL","authors":"O. Volodko, A. P. Bychenin, A. Khokhlov","doi":"10.18286/1816-4501-2022-3-12-19","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-12-19","url":null,"abstract":"The article provides analysis of the main directions for efficiency increase of diesel fuel sage for automotive and tractor equipment. The purpose of the study is to substantiate rational concentration of antiwear additive for diesel fuel containing surface active agent of organic origin. The possibility of using vegetable oils (flax, mustard and rapeseed) and their individual components (oleic acid) in low concentrations (up to 10%) as antiwear additives to diesel fuel is considered. According to results of laboratory studies on a tribometer of TU type with a four-ball friction unit, appropriate concentrations of antiwear additive were determined. According to results of the experiments, it was found that inclusion of up to 10% of vegetable oil (flax, mustard and rapeseed) to diesel fuel allowsto increase tribological properties of the fuel without negative effects. In this case, appropriate concentration is 2%, which allows to get maximum increase of tribological properties with minimumcosts of the additive. When using oleic acid, a concentration of 2% is also appropriate, but when the concentration exceeds 4%, there are such conditions in friction pairs that are favorable for the effect of adsorption strength decrease of the rubbing surfaces, which leads to an increase oftheir wear. Oleic acid application in the amount of more than 4% is considered impractical.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"119 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87341460","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"PHYSIOLOGICAL AND ZOOTECHNICAL SUBSTANTIATION FOR APPLICATION OF PROBIOTICS FOR REARING OF CALVES","authors":"S. Khimicheva, S. Moshkina","doi":"10.18286/1816-4501-2022-3-203-207","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-203-207","url":null,"abstract":"One of the urgent tasks of dairy cattle breeding is to obtain viable young animals, while the main factors in this issue are survivability and productivity increase of calves. In this regard, the goal was set to study the effectiveness of Probitox and Olin probiotics in rearing technology of dairy calves from a physiological and zootechnical points of view. The experiment was carried out on young black-and-white cattle. The feeding conditions of experimental animals corresponded to the feeding scheme adopted on the farm. The differences among the experimental groups consisted in application of various probiotics - the first experimental group received Probitox in addition to the main ration, the second experimental group received Olin. Comparative effectiveness of two probiotics: Probitox and Olin was presented in the course of the study, they demonstrated effectiveness in rearing technology of dairy calves. Thus, the growth rates of calves of the experimental groups significantly exceeded the control parametres, on average, by 3.3% (P<0.05). As far as average daily growth of young animals is concerned, a significant increase of thisparametre in the experimental groups was also noted - the average daily increase in the first experimental group was higher by 23.1%, in the second experimental group - by 18.7% in relation to the data of the control group. After assessing the hematological parameters of the young animals, it was found that introduction of probiotics into the ration did not adversely affect the functioning of the animals. The economic efficiency calculation showed that the profitability of production had a positive difference of 11% when using probiotics \"Probitox\" and \"Olin\" when compared to the control group.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"7 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87406954","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"PREVENTION OF METABOLIC DISTURBANCES OF NEWLY CALVED COWS","authors":"I. V. Voronova, N. Ignatieva, E. Nemtseva","doi":"10.18286/1816-4501-2022-3-192-198","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-192-198","url":null,"abstract":"Newly calved cows that do not receive a ration corresponding to their lactation performance before calving and during milking period become susceptible to ketosis with its adverse consequences. This disease is usually detected within the first 10-40 days after calving: cows lose weight very quickly and reduce milk productivity; they have many problems during calving and milking. Cows with high milk productivity are more prone to ketosis than cows of low productivity. Inclusion of propionates in the rations of cows helps to reduce formation of ketone bodies. The research was carried out atOOO Krasnoe Sormovo, Krasnoarmeiskiy district of the Chuvash Republic. The duration of the production experiment was 60 days before calving and 100 days afterwards. The results obtained during the research showed that the cows of the experimental group, whose ration included 150 g of propylene glycol per head per day two weeks before and 250 g within four weeks after calving, were healthy, their daily milk yield was 2.6 kg more than that of the control group of cows, milk productivity during the milking period was 4.42%. It allowedto obtain 4.2 tons more milk from the cows of the experimental group than from the cows of the control group. As far as the control group is concerned, 10% of the cows of this group had ketone bodies in milk,consequently, the same number of cows had a low fatness index, which indicated a lack of energy in the body in the period after calving.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"19 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89510608","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"AGROCHEMICAL PROPERTIES OF SOILS OF REPUBLIC OF MORDOVIA","authors":"V. Kargin, N. Ivanova, N. Neyaskin","doi":"10.18286/1816-4501-2022-3-70-75","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-70-75","url":null,"abstract":"The global nature of anthropogenic activity leads to profound and in some cases irreversible changes in biogeochemical cycles. The purpose of the work is to monitor the soils of the Republic of Mordovia. Initial parameters of the studied soils were used as a reference standard,in its relation the state of the soil cover was assessed.Mordovskiy State Center of Agrochemical Service has been conducting a system of regular observations on reference plots on the territory of the republic since 1993. They are located in different natural and climatic zones and reflect natural and climatic features of the main soil types. Organic matter accumulates on the soil surface and all upper horizons in the process of soil formation. For different soil types, there is a different ratio of the processes of supply of plant and animal residues and the processes of their transformation, and different intensity of these processes. The weighed mean content of humus was 7.6%, dark gray forest soils - 5.4%, gray forest soils - 3.9% and on alluvial soils - 4.7% on leached and podzolized black soils of the Republic of Mordovia. Soil samples of all soiltypes were taken in early spring before the start of spring field work (continuous survey), the results of their analyzesallow to assess their available nitrogen. Black soils and dark gray forest soils of the Republic of Mordovia are generally characterized by favorable physical and chemical properties: slightly acidic - close to neutral reaction of the medium, a relatively high amount of absorbed bases. Agrochemical properties of gray forest and soddy-podzolic soils worsen compared to those mentioned above. The content of mobile phosphorus and exchangeable potassium in the studied soils varies from low to very high, being average in most areas. Their content is determined not only by the soiltype, but also by soilcultivation state and application of mineral fertilizers.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"20 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89940585","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"THEORETICAL SUBSTANTIATION OF THE WORKING BODY PARAMETERS OF THE MINERAL FERTILIZER DISTRIBUTOR","authors":"I. Sidneva, V. Kurdyumov, A. Pavlushin","doi":"10.18286/1816-4501-2022-3-6-11","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-6-11","url":null,"abstract":"The study is devoted to solving the problem of reduction ofnonuniformityof application of mineral fertilizers. It was established that many factors influence distribution of fertilizers. The design of the working body of the mineral fertilizer distributor was developed and patented,it allows to increase the uniformity of fertilizer distribution. Differential and stochastic differential equations that describe the movement of fertilizer particles along the diskare given. The stochastic equation takes into account random impact interactions that inevitably arise during the motion of the particle flow. Dependences were obtained that determine the relation between such kinematic parameters of a fertilizer particle as the speed at the exit from the disk and the angle between the speed and the disk plane with geometric parameters of the distributor working body. The coordinates of the place where a fertilizer particle falls on the ground are determined, which allow to establish the dependence of the spreading width and distance on geometric and kinematic parameters of the working body, as well as physical and mechanical properties of fertilizers. In the course of the theoretical study, it was found that it is possible to regulate the torch of fertilizer spreading on the soil surfaceby changing the parameters of the working body of the mineral fertilizer distributor, which allows to achieveappropriate conditions that ensure the required uniform distribution of fertilizers.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"34 3","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"91469480","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
N. Feoktistova, A. Mastilenko, E. Suldina, I. I. Bogdanov
{"title":"DEVELOPMENT OF SYSTEMS FOR GENETIC DETECTION OF CORONATIN AND SYRINGOPEPTIN PHYTOTOXINS IN GENOMES OF PSEUDOMONAS SYRINGAE BACTERIOPHAGES","authors":"N. Feoktistova, A. Mastilenko, E. Suldina, I. I. Bogdanov","doi":"10.18286/1816-4501-2022-3-128-134","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-3-128-134","url":null,"abstract":"The article presents results of studies on development of systems for genetic detection of coronatin and syringopeptinphytotoxins in genomes of Pseudomonas syringae bacteriophages. A team of authors designed detection systems for fragments of determinants of pathogenicity factors (phytotoxins) – coronatin and syringopeptin with application of electronic resources of NCBI: BLAST nucleotide and PRIMER BLAST. Nucleotide sequences were determined, homologues characteristic of other phytopathogens were studied. The system of oligonucleotides (primers and probe) for detecting a fragment of Pseudomonas syringaephytotoxincoronatin genes (cma A gene) includes primers: forward - CAATTGCATCTCGTCGGCTG, reverse - ATTACAAGCGGCTAACGCCT, probe - BHQ1-ACCAACACGACGGCTTTCAGCC-Fam and syringopeptin (syp C gene): forward primer - CTTGCAGCTT , reverse - TTGCATCGGTTCGTCCAGTC, probe - BHQ1-TGCGCACTGCACTGGTCTGG-Fam. A number of experiments were carried out to improve the amplification protocol: DNA denaturation at a temperature of 95 0C for 300 seconds once; primer annealing - at a temperature of 95 0C for 10 seconds, at a temperature of 60 0C for 30 seconds - 5 cycles; elongation - at a temperature of 95 0C for 5 seconds, at a temperature of 60 0C for 10 seconds fluorescence - 40 cycles. According to the amplification data, these determinants of coronatin and syringopeptin were not identified in the genomes of bacteriophages Ps.s.7 UlGAU and Ps.s.27 UlGAU, which are part of biological product. When studying the genome of the bacterial strain Pseudomonas syringae № 3, used as a mother culture in production of bacteriophage biomass, coronatin and syringopeptin determinants were identified.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"25 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"85675468","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}