N. Feoktistova, A. Mastilenko, E. Suldina, A. Lomakin
{"title":"DEVELOPMENT AND TESTING OF POLYMERASE CHAIN REACTION FOR INDICATION AND IDENTIFICATION OF ASPERGILLUS FLAVUS PHYTOPATHOGENIC FUNGI","authors":"N. Feoktistova, A. Mastilenko, E. Suldina, A. Lomakin","doi":"10.18286/1816-4501-2022-4-111-116","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-111-116","url":null,"abstract":"The article presents results of research on development of a test system by means of polymerase chain reaction with real-time detection for identification of Aspergillus flavus phytopathogenic fungi. The above microscopic fungi are contaminants of corn in various geographical areas. At present, a multiplex PCR-RT-test system \"HRM-Zygo-Asp\" is in operation for detection and identification of aspergillus (only to the genus) and a commercial test system for EIA \"Aspergillus-IgG- EIA -BEST\" (ZAO \"VECTOR- BEST). The team of authors chose Aspergillus flavus strain CA14 4,044,380..4,045,732 b.p. for research, used Multiple Sequence Alignment Viewer 1.22.1 software, UGENA 44.0, NCBI BLAST-primer, Oligoevaluator. Specific primers were selected (f) 5'-3' GGGCCCGCAGCAAGAATAC, reverse primer - (r) 3'-5' ACGAGTTGTCACCTTCCCGAGA; a reaction protocol was developed, including preliminary denaturation - 95 0C - 5 minutes (1 cycle); denaturation - 95 0C - 5 sec, annealing - 60 0C - 15 sec (50 cycles). To determine the sensitivity of the test system, the authors selected a probe (CGGTTCGCTTTGGTCATCGT), a fluorescent dye - HEX, and a quencher - BHQ-2. It was determined that the sensitivity of the test system is 1000 cells. Approbation of the scientific development was carried out on 33 field strains isolated from 33 corn samples (grain, vegetative mass with signs of disease) and a reference strain (Aspergillus flavus VKM № F-25). When choosing field strains identified by V.I. Bilay and E.Z. Koval (1988) and the key of Nikitinskiy-Aleev, it was established that 25 samples were contaminated with bacteria of Aspergillus flavus species.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"5 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"85344511","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
E. Romanova, V. Romanov, V. Lubomirova, E. Fazilov
{"title":"TECHNOLOGY OF ENRICHMENT OF YOUNG ARTEMIA NAUPLII AND EFFICIENCY OF THEIR USAGE AS STARTING FEEDS","authors":"E. Romanova, V. Romanov, V. Lubomirova, E. Fazilov","doi":"10.18286/1816-4501-2022-4-150-155","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-150-155","url":null,"abstract":"Enrichment of artemia with biologically active substances has three main ways - through the intestines, gills and integuments. The possibility of enrichment of artemia through the body integuments exists only for the first two days after hatching, when nauplii have soft and thin integuments. Enrichment through the intestines becomes possible only at the stage of metanauplii, which comes after the first molting when the mouth appears and the digestive system is formed. We chose enrichment through the skin of nauplii of the 1st development stage, since early nauplii are an ideal food for fish larvae at the stage of transition to exogenous feeding. The purpose of the research is to develop enrichment technology and to obtain live starting feeds with the vitalizer properties containing biologically active substances: adaptogens, probiotics, a vitamin and amino acid complex that heal the fish body, form intestinal microbiocenosis, increase growth and development rate, endurance, resistance to psychogenic and oxidative stress, increase survivability, reduce the level of cannibalism. As a result, we obtained Artemia nauplii enriched with Sporothermin probiotic, Irkutin adaptogen, Chiktonik vitamin-amino acid complex, which were used to rear larvae and fry of the African catfish. The results of the studies showed that usage of enriched nauplii accelerates fish growth, increases the proportion of \"giants\" with a mass more than twice the average for the population, reduces the level of cannibalism, increases survivability of fish, retaining these tendencies throughout the entire rearing period.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"1 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"82118487","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
A. Kulikova, E. Yashin, E. A. Cherkasov, E. Volkova
{"title":"THE ROLE OF ORGANIC FERTILIZERS (STRAW, GREEN MANURE, CROP-ROOT REMAINS) IN HUMUS REPRODUCTION AND PRESERVATION IN THE SOIL","authors":"A. Kulikova, E. Yashin, E. A. Cherkasov, E. Volkova","doi":"10.18286/1816-4501-2022-4-53-58","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-53-58","url":null,"abstract":"The paper presents results of thestudies on assessment of the role of organic substances created in crop rotation agrocenoses and used as fertilizer for agricultural crops (straw, green manure, crop- root residues). The studies were carried out in a five-field grain crop rotation with alternation: vetch-oat mixture as a green manure crop - winter wheat - millet - spring wheat - barley. The scheme of the experiment consisted of six variants with application of organic, organo-mineral and mineral fertilizers: 1. Control (green manure); 2. Straw of the forecrop; 3.Straw of the forecrop+ 10 kg of nitrogen (urea) per 1 ton of straw; 4.Straw of the forecrop+ Biocomposite-correctbiological preparation; 5.Biocomposite-correctbiopreparation; 6. NPK (doses of fertilizers for the planned yield of winter wheat 4.5 t/ha, millet 4.0 t/ha, spring wheat 4.0 t/ha, barley 4.0 t/ha). It was found that usage of straw as an organic fertilizer contributes to an increase of crop yields in the first year of application. Its effectiveness is greatly increased in combination with a nitrogen supplement and a biological product: the increase of grain yield was (depending on crops) from 0.19 to 0.51 t/ha. The amount of organic matter entering the soil per 1 hectare of crop rotation area in case of combined usage of green manure, straw and crop-root residues was 2 times higher than the control variant (green manure). Complete reproduction and preservation of humus content is possible in case of combined usage of green manure, straw, crop- root residues and biological preparations as organic fertilizers in order to improve the conditions of their decomposition.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"81 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89858320","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
E. Suldina, I. I. Bogdanov, N. Feoktistova, N. Bart
{"title":"PROTEIN PROFILING OF CANDIDATE STRAINS OF BACTERIAL COMPOSITION","authors":"E. Suldina, I. I. Bogdanov, N. Feoktistova, N. Bart","doi":"10.18286/1816-4501-2022-4-102-110","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-102-110","url":null,"abstract":"Organic farming and the application of organic and biological fertilizers and protective equipment is not only a promising, but also a safe way to obtain food products. Various bacterial compositions are widely used to increase the microbial activity of the soil, which increases the availability of nutrients that plants can easily absorb. They increase soil fertility by fixing nitrogen and dissolve insoluble phosphates in the soil, resulting in the formation of chemicals that promote plant growth. The aim of this work was to determine the presence of phytase, nitrogenase and alkaline phosphatase enzymes in strains of candidate bacteria of bacterial composition by proteomic profiling in polyacrylamide gel. The molecular weights of phytase, nitrogenase and phosphotase of candidate strains were determined in the system http://molbiol.ru/ based on amino acid sequences. After that, proteins with the corresponding molecular weights were detected on the forogram. According to the results of proteomic analysis of Bacillus subtilis, proteins with molecular weights of 50.5, 16.5 and 74.9 kDa corresponding to the enzymes phytase, nitrogenase and phosphatase were identified in 10 strains. Proteins with molecular weights of 41.8, 16.7 and 24.8 kDa corresponding to the enzymes phytase, nitrogenase and phosphatase were detected in 6 strains of Bacillus megaterium. 4 strains of Pseudomonas stutzeri contained proteins with molecular weights of 69, 31.8 and 73.5 kDa corresponding to the required enzymes. As a result of the carried out experiments, candidates bacterial strains were identified for the development of a biocomposition to increase the coefficient of assimilation of mineral components of fertilizers.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"14 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89186547","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"CONSISTENT PATTERNS IN FORMATION OF YIELD AND YIELD INCREASE OF COMMON MILLET IN THE CENTRAL ZONE OF THE ORENBURG CIS-URAL REGION","authors":"R. D. Kamaleev, A. Neverov","doi":"10.18286/1816-4501-2022-4-27-31","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-27-31","url":null,"abstract":"The productivity of millet per area unit is determined by three components of yield structure. The increase of yield is created by additive effect of differences in these components in the compared varieties. The aim of the study was to identify patterns in yield dispersion and yield increase dispersion of common millet grain. The research was carried out in Orenburg region of the Russian Federation. The materials of the research were long series of observations in the breeding nurseries of common millet of the Federal State Budgetary Scientific Institution Federal Scientific Center of Biological Systems and Agrotechnologies of the Russian Academy of Sciences. The relation was analyzed using the multiple linear regression method. Multivariate analysis revealed that the role of indexes in determination of dispersion of yield increase differs significantly from the role of yield structure elements in specification of the spread of yield values. Thus, if the share of the influence of the panicle grain content on dispersion of the yield of millet grain is 67.5% of cases, then the share of the influence of the index of this selectable trait on variation in yield increase is 49.4% of cases. At the same time, the share of other indexes increases (from 17.9% to 28.0% - an increase of the index of the number of productive stems and from 5.6% to 11.6% - an increase of the mass index of 1000 grains). For practical millet breeding, selection numbers with better panicle grain content and high agro-ecological stability of crop formation in thickened crops are of great interest.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"67 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84936403","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"RESULTS OF ENVIRONMENTAL TEST OF PILOT BLACK CURRANT VARIETY","authors":"E. Chebotok","doi":"10.18286/1816-4501-2022-4-91-95","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-91-95","url":null,"abstract":"The purpose of the study is replenishment of the assortment of black currant for the Volga-Vyatka region. The blackcurrant variety Pilot was bred in the conditions of the Middle Urals, at Sverdlovsk horticultural breeding station. It was obtained from free pollination of Valovaya variety. Pilot variety was tested in five regions of the Russian Federation - in the system of state variety testing and in various scientific and educational institutions under scientific cooperation agreements. The studies were carried out according to the \"Program and Methodology for the Study of Fruit, Berry and Nut Crops\" (Oryol, 1999). In 2021, Pilot variety deservedly replenished the assortment of black currant for cultivation in the Volga-Vyatka (4) region,it is also suitable for cultivation in other regions of the Russian Federation. Pilot variety can serve as a starting material for further improvement of the blackcurrant assortment. Brief morpho-biological description includes: the variety is winter-hardy, drought-resistant, high yield, in some years up to 240 dt/ha. The bush is medium or tall, semi-spreading;medium-term flowering, medium-late ripening of berries, self-fertility - 66%, a variety with high resistance to powdery mildew and bud mites. The leaves are little affected by septoria. Fruit raceme is medium. Berries are with an average weight of 1.5 g, maximum - 5 g, black, rounded, relatively one-dimensional. The taste is sweet and sour, the skin is dense, but not rough, the separation is dry. The nomenclature standards for blackcurrant varieties selected by Sverdlovsk Horticultural Breeding Station, including the Pilot variety (WIR-54127), included in the Herbarium of Cultivated Plants of the World, Their Wild Relatives and Weeds (WIR) have been published in co-authorship with the staff of FSBSIFederal Research Center All-Russian Institute of Plant Genetic Resources.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"9 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"80901791","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"INFLUENCE OF ABIOTIC ENVIRONMENTAL FACTORS, MINERAL FERTILIZERS AND FORECROPS ON YIELD OF MILLET GRAIN IN THE STEPPE ZONE OF THE SOUTHERN URALS","authors":"D. Mitrofanov","doi":"10.18286/1816-4501-2022-4-64-70","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-64-70","url":null,"abstract":"The article presents a study of millet in the system of dry farming, depending on abiotic factors of the environment of the steppe zone of the Southern Urals. The paper compiles long-term data (2002-2021) on air temperature, precipitation, dry wind days and millet grain yield in Orenburg region. Studies of millet were carried out on the experimental field plot founded in 1990 on southern black soils of Orenburg region. The aim of the study is to determine the best impact of unregulated weather factors (precipitation, temperature, dry winds) on millet yield in crop rotations and in monocrops after application of mineral fertilizers. The research was carried out according to generally accepted method of field experiment. The object of the experiment is millet. The scheme of the experiment consists of six variants of millet sowing in four repetitions. Based on the interesting points of the study, the maximum rainfall for July is 42.2 mm and for June is 33.3 mm. Elevated temperature is observed in July 22.8 °C and the largest number of dry windy days in August is 18. The average temperature for the period (May-August) is 20.5 °C, precipitation is 125.6; 116.3 mm, dry winds - 64.0 days. There is mainly a negative reaction of millet to mineral fertilizers in the study, leading to a yield decrease ranging from 0.80 to 0.52 t/ha. The fifth variant in a two-field crop rotation has the highest yield on the agricultural background with fertilizers of 1.21 t/ha. As a result of statistical analysis of the data, it is revealed that the best impact on millet yield at two levels of agricultural background is exerted by precipitation that fell in July, except the fifth variant. The share of the influence of July precipitation was notedly determined in the second variant of the field experiment and was 70.81; 66.05% at a significance level of 0.000003; 0.000013. It is necessary to cultivate millet after hard wheat in a two-field crop rotation, since usage of fertilizers provides an increase by 0.35 tons of grain.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"42 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81864442","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"INFLUENCE OF INTENSIFICATION LEVELS ON WEED INFESTATION OF CROPS AND GRAIN YIELD OF BARLEY IN THE CONDITIONS OF KURSK REGION","authors":"T. Dudkina, N. Dolgopolova","doi":"10.18286/1816-4501-2022-4-21-26","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-21-26","url":null,"abstract":"Studies were carried out in Kursk region in 2015-2017, their purpose was to study different methods of basic tillage and herbicides in cultivation of spring barley of Suzdalets variety. The soil of the experimental plot is dark gray forest medium loamy soil with humus content of 2.43%. The barley was grown in a 7-field grain fallow crop rotation, where barley was preceded by spring wheat. The composition of weeds was dominated by non-annualDicotyledoneae. The number of weeds in crops was 7.2 pcs/m2 less in case of plowing than in case of fine mulching. When tilling without soil overturning, the infestation with perennial root weeds increased by 1.8 times compared to plowing. Herbicides effectively reduced the infestation of crops for all tillage methods. The best results were obtained when crops were sprayed with Caliber (50 g/ha) + Trend (0.2 l/ha) herbicides - 95.9% reduction of weed infestation in case of plowing, 95.2% - in case of fine mulching. The highest barley yield in the experiment was in case of plowing and applying of Caliber (50 g/ha) + Trend (0.2 l/ha) herbicides - 4.99 t/ha. The weight of 1000 grains was also the highest in this variant. The replacement of plowing with soil protection tillage led to some decrease of spring barley yield. The length of the head, the number of grains per head, the grain weight from 1 head and the weight of 1000 grains were higher in the variants with application of herbicides, compared to the control. The calculation of economic efficiency showed that the most advantageous is barley cultivation with application of Caliber (50 g/ha) + Trend (0.2 l/ha) herbicides for weed control during the growing season, but with fine mulching tillage, since this type of tillage can reduce the cost of crop cultivation.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"24 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84847900","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
E. Suldina, N. Feoktistova, A. Lomakin, A. Vasilenko
{"title":"DEVELOPMENT OF PRIMER SYSTEM AND PROBE FOR IDENTIFICATION OF STAPHYLOCOCCUS AUREUS BY PCR-RV","authors":"E. Suldina, N. Feoktistova, A. Lomakin, A. Vasilenko","doi":"10.18286/1816-4501-2022-4-137-142","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-137-142","url":null,"abstract":"The article presents the results of the development and testing of original system of primers and a probe for the identification of bacteria of the Staphylococcus aureus species by polymerase chain reaction in «real time» mode. The extension of domestic poultry industry opens up opportunities for the incidence rate of zoonoses. Staphylococci are one of the leading pathogens of bacterial infections in birds, and Staphylococcus aureus causes a wide range of diseases in chickens, including septic arthritis, subcutaneous abscesses and gangrenous dermatitis. Therefore, the development of methods for the timely detection of pathogenic variants of Staphylococcus aureus is an important task of food safety. For the development of a molecular genetic identification system, a unique DNA region of Staphylococcus aureus K39 NODE_3_length_262400_cov_12.378: 113,355..114,623 bp encoding transcription regulator U32 family peptidase was selected. With the help of the BLAST-primer NCBI resource, the UGENA program and the Oligoevaluator resource, the selection and design of oligonucleotide primers and a fluorescent probe for PCR were carried out. Optimization of primer systems showed that the optimal concentration is 3 pM of each primer per reaction, and an increase in the concentration of primers does not affect the effectiveness of the reaction. It has been experimentally established that the optimal concentration of the fluorescent probe in the reaction is 0.4 pM. Protocols have been selected for PCR-RV both in the presence of intercalating dye SYBR Green and using a fluorescent probe.The species specificity of selected primer systems was confirmed experimentally on 9 strains of heterologous bacterial genera and amounted to 100%. The sensitivity of primer system and probe was 102 copies.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"4 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84120743","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"DEVELOPMENT AND APPROVAL OF THE SCHEME OF ISOLATION, INDICATION AND IDENTIFICATION OF B.PETRII BACTERIA FROM ENVIRONMENTAL OBJECTS","authors":"A. Lomakin","doi":"10.18286/1816-4501-2022-4-117-123","DOIUrl":"https://doi.org/10.18286/1816-4501-2022-4-117-123","url":null,"abstract":"The article is devoted to development and testing of a scheme for isolation, indication and identification of Bordetella petrii bacteria from environmental objects. Until now, the role of B. petrii in infectious processes has not been sufficiently studied, due to the imperfection of research procedure. The research methodology was based on usage of nutrient media of the original author's formulation - accumulation and differential diagnostic and classical bacteriological tests for establishment of physiological and biochemical properties of microorganisms. As a result of the research, an algorithm was proposed that allows to detect from 10 bacterial cells of the desired bacterial species in biological material using bacteriological and molecular genetic methods. Approbation of the developed scheme allowed to isolate three new strains of B. petrii bacteria from environmental objects. Their species identity was proved by bacteriological and molecular genetic studies, in particular, the morphology of bacterial cells, cultural and biochemical properties were studied, the species-specific region of B. petrii genome was identified by LAMP method and 16S RNA, characteristic of bacteria of Bordetella genus. The obtained results allow to judge the spread of this infectious agent in the environment.","PeriodicalId":23563,"journal":{"name":"Vestnik of Ulyanovsk state agricultural academy","volume":"33 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"86898992","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}