{"title":"Therapeutic effects of a novel venom abstract (ZK002) solution in an alkali-burned corneal wound-healing model.","authors":"Wen-Yan Peng, Fei Wang, Shuang-Jian Yang, Qin-Yan Sun, Heng-Shen Zhou, Xiaoyi Li, Zheng-Xuan Jiang, Shi-You Zhou","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Corneal alkali burns can progress to corneal epithelial defects, inflammation, scarring, and angiogenesis, potentially leading to blindness. Therefore, we examined the therapeutic effects of a novel ophthalmic solution (ZK002) on wound healing in alkali-burned rat corneas.</p><p><strong>Methods: </strong>In this study, we attempted to treat alkali-exposed rat corneas using topical application of either an ophthalmic solution with ZK002 or an anti-vascular endothelial growth factor agent for 14 days. We evaluated corneal edema, corneal neovascularization area, and histological changes. We also assessed the inflammatory (MMP-9, MMP-2, and interleukin-1β) and angiogenic (vascular endothelial growth factor receptor 2, VEGFR2) markers. Levels of inflammatory (matrix metalloproteinase (MMP)-9, MMP-2, and interleukin-1β), profibrotic (α-smooth muscle actin, α-SMA; transforming growth factor-β2,TGF-β2), and angiogenic (vascular endothelial growth factor-receptor 2, VEGFR2) factors, as well as peroxisome proliferator-activated receptor γ (PPARγ) mRNA expression, were measured.</p><p><strong>Results: </strong>The analyses showed that alkali exposure caused an increase in corneal edema and fibrosis with corneal neovascularization. The accumulation of α-smooth muscle actin-positive myofibroblasts and the deposition of transforming growth factor-β2 on the alkali-exposed corneas were noted on day 14. The mRNA expression levels of interleukin-1β, MMP-9, MMP-2, VEGFR2, and profibrotic factors were decreased in the ZK002 group compared with the control group during the early period of corneal alkali burns on day 14. However, the expression level of PPARγ mRNA was increased in the ZK002 group.</p><p><strong>Conclusions: </strong>ZK002 decreased the fibrotic reaction and prevented neovascularization in the cornea after an alkali burn. Therefore, the novel ophthalmic solution ZK002 could be a potentially promising therapeutic clinical treatment for corneal wound healing.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"317-328"},"PeriodicalIF":1.8,"publicationDate":"2023-12-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10805332/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139542376","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-12-15eCollection Date: 2023-01-01
Olubayo U Kolawole, Cheryl Y Gregory-Evans, Riyaz Bikoo, Albert Z Huang, Kevin Gregory-Evans
{"title":"Novel pathogenic variants in Tubulin Tyrosine Like 5 (<i>TTLL5)</i> associated with cone-dominant retinal dystrophies and an abnormal optical coherence tomography phenotype.","authors":"Olubayo U Kolawole, Cheryl Y Gregory-Evans, Riyaz Bikoo, Albert Z Huang, Kevin Gregory-Evans","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Autosomal recessive cone and cone-rod dystrophies (CD/CRD) are inherited forms of vison loss. Here, we report on and correlate the clinical phenotypes with the underlying genetic mutations.</p><p><strong>Methods: </strong>Clinical information was collected from subjects, including a family history with a chart review. They underwent a full ophthalmic examination, including best-corrected visual acuity, direct and indirect ophthalmoscopy, color vision testing, color fundus photography, contrast sensitivity, autofluorescence, and spectral domain-optical coherence tomography (SD-OCT), and full-field electroretinography. Next-generation panel-based genetic testing was used to identify DNA variants in subject buccal swab samples.</p><p><strong>Results: </strong>Genetic testing in two patients revealed three novel variants in the <i>TTLL5</i> gene associated with CD/CRD: two missense variants (c.1433G>A;p.(Arg478Gln), c.241C>G;p.(Leu81Val), and one loss-of-function variant (c.2384_2387del;p.(Ala795Valfs*9). Based on <i>in-silico</i> analysis, structural modeling, and comparison to previously reported mutations, these novel variants are very likely to be disease-causing mutations. Combining retinal imaging with SD-OCT analysis, we observed an unusual sheen in the CD/CRD phenotypes.</p><p><strong>Conclusion: </strong>Based on the protein domain location of novel <i>TTLL5</i> variants and the localization of TTLL5 to the connecting cilium, we conclude that the CD/CRD disease phenotype is characterized as a ciliopathy caused by protein tracking dysfunction. This initially affects cone photoreceptors, where photoreceptor cilia express a high level of TTLL5, but extends to rod photoreceptors over time. Fundus photography correlated with SD-OCT imaging suggests that the macular sheen characteristically seen with <i>TTLL5</i> mutations derives from the photoreceptor's outer segments at the posterior pole.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"329-337"},"PeriodicalIF":1.8,"publicationDate":"2023-12-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10805330/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139542363","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-11-06eCollection Date: 2023-01-01
Yang Liu, Yangbin Huang, Zihan Guo, Chengcheng Yang, Yunzepeng Li, Binhui Li, Ye Liu, Hui Zheng
{"title":"Sulforaphane inhibits TGF-β-induced fibrogenesis and inflammation in human Tenon's fibroblasts.","authors":"Yang Liu, Yangbin Huang, Zihan Guo, Chengcheng Yang, Yunzepeng Li, Binhui Li, Ye Liu, Hui Zheng","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Subconjunctival fibrosis is the main cause of failure after glaucoma filtration surgery. We explored the effects of sulforaphane (SFN) on the conversion of human Tenon's fibroblasts (HTFs) into myofibroblasts, transforming growth factor (TGF)-β-induced contraction of collagen gel, and inflammation.</p><p><strong>Methods: </strong>After treatment with the combination of TGF-β and SFN or TGF-β alone, primary HTFs were subjected to a three-dimensional collagen contraction experiment to examine their contractility. Levels of α smooth muscle actin (α-SMA), synthesis of extracellular matrix (ECM), and phosphorylation of various signaling molecules were determined by western blot or quantitative reverse transcription-polymerase chain reaction (RT-qPCR). Fluorescence microscopy was employed to examine stress fiber formation in HTFs. The expressions of interleukin (IL)-6, IL-8, and connective tissue growth factor (CTGF) were determined using RT-qPCR.</p><p><strong>Results: </strong>The contraction of myofibroblasts caused by TGF-β was significantly suppressed by SFN. This suppressive effect was exerted via the differentiation of HTFs into myofibroblasts by inhibiting the production of fibronectin and the expression of α-SMA. Moreover, SFN treatment reduced the expression of TGF-β-promoted integrins β1 and α5, myosin light chain (MLC) phosphorylation, and stress fiber formation, as well as the expression of IL-6, IL-8, and CTGF. Finally, TGF-β-induced Smad2/3 and extracellular signal-regulated kinase (ERK) phosphorylations were attenuated by SFN.</p><p><strong>Conclusions: </strong>SFN inhibits HTF contractility, differentiation into myofibroblasts, and inflammation caused by TGF-β. These effects are mediated by both classic and non-classic signaling pathways. Our results indicate that SFN has potent anti-fibrotic and anti-inflammatory effects in HTFs and is a potential candidate for subconjunctival fibrosis therapy.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"306-316"},"PeriodicalIF":1.8,"publicationDate":"2023-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10805336/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139542368","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-11-06eCollection Date: 2023-01-01
Luis J Knight, Renita M Martis, Paul J Donaldson, Monica L Acosta, Julie C Lim
{"title":"Changes in glutamate and glutamine distributions in the retinas of cystine/glutamate antiporter knockout mice.","authors":"Luis J Knight, Renita M Martis, Paul J Donaldson, Monica L Acosta, Julie C Lim","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The cystine/glutamate antiporter is involved in the export of intracellular glutamate in exchange for extracellular cystine. Glutamate is the main neurotransmitter in the retina and plays a key metabolic role as a major anaplerotic substrate in the tricarboxylic acid cycle to generate adenosine triphosphate (ATP). In addition, glutamate is also involved in the outer plexiform glutamate-glutamine cycle, which links photoreceptors and supporting Müller cells and assists in maintaining photoreceptor neurotransmitter supply. In this study, we investigated the role of xCT, the light chain subunit responsible for antiporter function, in glutamate pathways in the mouse retina using an xCT knockout mouse. As xCT is a glutamate exporter, we hypothesized that loss of xCT function may influence the presynaptic metabolism of photoreceptors and postsynaptic levels of glutamate.</p><p><strong>Methods: </strong>Retinas of C57BL/6J wild-type (WT) and xCT knockout (KO) mice of either sex were analyzed from 6 weeks to 12 months of age. Biochemical assays were used to determine the effect of loss of xCT on glycolysis and energy metabolism by measuring lactate dehydrogenase activity and ATP levels. Next, biochemical assays were used to measure whole-tissue glutamate and glutamine levels, while silver-intensified immunogold labeling was performed on 6-week and 9-month-old retinas to visualize and quantify the distribution of glutamate, glutamine, and related neurochemical substrates gamma-aminobutyric acid (GABA) and glycine in the different layers of the retina.</p><p><strong>Results: </strong>Biochemical analysis revealed that loss of xCT function did not alter the lactate dehydrogenase activity, ATP levels, or glutamate and glutamine contents in whole retinas in any age group. However, at 6 weeks of age, the xCT KO retinas revealed altered glutamate distribution compared with the age-matched WT retinas, with accumulation of glutamate in the photoreceptors and outer plexiform layer. In addition, at 6 weeks and 9 months of age, the xCT KO retinas also showed altered glutamine distribution compared with the WT retinas, with glutamine labeling significantly decreased in Müller cell bodies. No significant difference in GABA or glycine distribution were found between the WT and xCT KO retinas at 6 weeks or 9 months of age.</p><p><strong>Conclusion: </strong>Loss of xCT function results in glutamate metabolic disruption through the accumulation of glutamate in photoreceptors and a reduced uptake of glutamate by Müller cells, which in turn decreases glutamine production. These findings support the idea that xCT plays a role in the presynaptic metabolism of photoreceptors and postsynaptic levels of glutamate and derived neurotransmitters in the retina.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"274-288"},"PeriodicalIF":2.2,"publicationDate":"2023-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784226/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466085","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-11-06eCollection Date: 2023-01-01
Jillian F Ziemanski, Landon Wilson, Stephen Barnes, Kelly K Nichols
{"title":"Evaluation of the effects of latanoprost and benzalkonium chloride on the cell viability and nonpolar lipid profile produced by human meibomian gland epithelial cells in culture.","authors":"Jillian F Ziemanski, Landon Wilson, Stephen Barnes, Kelly K Nichols","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The purpose of this study was to explore the effects of a PGF<sub>2α</sub> analog, latanoprost, and its preservative, benzalkonium chloride (BAK), on the cell viability and lipidomic expression of immortalized human meibomian gland epithelial cells (HMGECs).</p><p><strong>Methods: </strong>Differentiated HMGECs were exposed to latanoprost (0.05 to 50 µg/ml), BAK (0.2 to 200 µg/ml), or combined latanoprost-BAK (0.05-0.2 to 50-200 µg/ml). EP- and FP-type receptors, the cognate receptors of PGE<sub>2</sub> and PGF<sub>2α</sub>, were inhibited, thereby sparing and isolating the function of each receptor to one condition. Cell viability was assessed by ATP quantitation, and lipid extracts were analyzed by ESI-MSMS<sup>ALL</sup> with a Triple TOF 5600 Mass Spectrometer (SCIEX, Framingham, MA) using SCIEX LipidView 1.3.</p><p><strong>Results: </strong>Latanoprost and BAK were found to be lethal to HMGECs at the highest concentrations (p < 0.001 for both). The cytotoxicity of latanoprost was mediated through FP- and EP-independent mechanisms. Both latanoprost and BAK significantly modulated the lipidomic expression of several cholesteryl esters (8% and 30%, respectively) and triacylglycerols (10% and 12%, respectively). The combined latanoprost-BAK agent appeared to be no more toxic and to only negligibly alter the lipid profile relative to its individual components.</p><p><strong>Conclusions: </strong>The use of latanoprost and BAK in glaucoma may alter the viability of the meibomian glands and their lipid expression in vivo. Sublethal concentrations of BAK appear to modulate meibum lipid expression, particularly in relation to sterol biosynthesis. Non-preserved latanoprost had less cytotoxicity at lower doses and fewer lipidomic effects compared to BAK, further strengthening the argument in favor of BAK-free pharmaceutical preparations.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"289-305"},"PeriodicalIF":1.8,"publicationDate":"2023-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10805331/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139542357","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-11-05eCollection Date: 2023-01-01
Xi He, Caixia Lin, Fengchuan Zhang, Sanguo Zhang, Mengtian Kang, Shifei Wei, He Li, Ningli Wang, Shi-Ming Li
{"title":"Outdoor time influences VIPR2 polymorphism rs2071623 to regulate axial length in Han Chinese children.","authors":"Xi He, Caixia Lin, Fengchuan Zhang, Sanguo Zhang, Mengtian Kang, Shifei Wei, He Li, Ningli Wang, Shi-Ming Li","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Clinical relevance: </strong>Identification of individuals with a higher risk of developing refractive error under specific gene and environmental backgrounds, especially myopia, could enable more personalized myopic control advice for patients.</p><p><strong>Background: </strong>Refractive error is a common disease that affects visual quality and ocular health worldwide. Its mechanisms have not been elaborated, although both genes and the environment are known to contribute to the process. Interactions between genes and the environment have been shown to exert effects on the onset of refractive error, especially myopia. Axial length elongation is the main characteristic of myopia development and could indicate the severity of myopia. Thus, the purpose of the study was to investigate the interaction between environmental factors and genetic markers of VIPR2 and their impact on spherical equivalence and axial length in a population of Han Chinese children.</p><p><strong>Methods: </strong>A total of 1825 children aged 13~15 years in the Anyang Childhood Eye Study (ACES) were measured for cycloplegic autorefraction, axial length, and height. Saliva DNA was extracted for genotyping three single-nucleotide polymorphisms (SNPs) in the candidate gene (VIPR2). The median outdoor time (2 h/day) was used to categorize children into high and low exposure groups, respectively. Genetic quality control and linear and logistic regressions were performed. Generalized multifactor dimensional reduction (GMDR) was used to investigate gene-environment interactions.</p><p><strong>Results: </strong>There were 1391 children who passed genetic quality control. Rs2071623 of VIPR2 was associated with axial length (T allele, β=-0.11 se=0.04 p=0.006), while SNP nominally interacted with outdoor time (T allele, β=-0.17 se=0.08 p=0.029). Rs2071623 in children with high outdoor exposure had a significant interaction effect on axial length (p=0.0007, β=-0.19 se=0.056) compared to children with low outdoor exposure. GMDR further suggested the existence of an interaction effect between outdoor time and rs2071623.</p><p><strong>Conclusions: </strong>Rs2071623 within VIPR2 could interact with outdoor time in Han Chinese children. More outdoor exposure could enhance the protective effect of the T allele on axial elongation.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"266-273"},"PeriodicalIF":2.2,"publicationDate":"2023-11-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784227/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466371","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Investigation of the antioxidant effect of Chrysin in an experimental cataract model created in chick embryos.","authors":"Gülan Albaş Kurt, Tolga Ertekin, Emre Atay, Abdülkadir Bilir, Halit Buğra Koca, Esra Aslan, Alperen Sarıtaş","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Cataract, which occurs as a result of lens opacification, is one of the most common causes of vision loss. In the literature, deterioration of the antioxidant system due to the increase in reactive oxygen species and oxidant levels is shown among the causes of cataract formation. The aim of this study was to investigate the antioxidant effect of chrysin on steroid-induced cataract development in an experimental chick embryo model using morphological, histological and biochemical parameters.</p><p><strong>Methods: </strong>Within the scope of the study, 150 specific pathogen free (SPF) fertilized eggs were used. Eggs were divided into 6 groups as control (group 1), corn oil (group 2), hydrocortisone hemisuccinate sodium (HC) (group 3), low dose chrysin (group 4), medium dose chrysin (group 5) and high dose chrysin (group 6). On the 15th day of incubation, Chrysin and HC were applicated to the air sac of the eggs with Hamilton and/or insulin injector. On day 17, the chick embryos were removed from the eggs and the bulbus oculi of the embryos were dissected. Lenses of 9 embryos were used for morpholigical cataract grading in each group, lens of 8 embryos for biochemical analysis and intact eyes of 7 embryos for histological evaluation (TUNEL method).</p><p><strong>Results: </strong>No opacity was observed in any of the lenses in Group 1 and 2. Cataract was observed in all lenses in Group 3. The mean opacity grades in group 3 were statistically significantly higher when compared to group 1 and 2 (p<0.05). The difference between group 6 and group 3 was statistically significant (p<0.05). GSH and TAS levels in the lenses were statistically significantly decreased compared to the control group due to HC application (p<0.05). It was determined that the decreased GSH and TAS levels in the lenses increased in relation to the Chrysin application doses. The increased levels of MDA, TOS, caspase 3 and caspase 9 in the HC group decreased significantly depending to the chrysin doses (p<0.05). In addition, while the rate of apoptotic cells determined by the TUNEL method was statistically significantly higher in the HC administered group than in the control group (p<0.05), it was statistically significantly decreased in the chrysin-administered groups, in relation to the dose of chrysin (p<0.05).</p><p><strong>Conclusions: </strong>We think that anti-cataract effect of crhysin may be due to the antioxidant and antiapoptotic properties of chrysin. However, more research is needed to clarify the anti-cataract effects of chrysin.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"245-255"},"PeriodicalIF":2.2,"publicationDate":"2023-11-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784222/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466274","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-11-05eCollection Date: 2023-01-01
Athar Shadmani, Trent Jarin, Xiang Qi Meng, Yugendran Rajaendran, Salih Uzun, Albert Y Wu
{"title":"Evaluation of the Algerbrush II rotating burr as a tool for inducing ocular surface failure in a mouse model.","authors":"Athar Shadmani, Trent Jarin, Xiang Qi Meng, Yugendran Rajaendran, Salih Uzun, Albert Y Wu","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The Algerbrush II has been widely used to induce corneal and limbal injuries in animal models. The extent of injury varies with the duration of exposure, pressure from the placement of the burr, and the size of the burr. However, no study has explored the correlation between the duration of exposure and the severity of injury in mouse model with corneal and limbal stem cell deficiency (LSCD) induced using the Algerbrush II. Therefore, this study aimed to evaluate the variations in the severity of corneal and limbal injury with different durations of the Algerbrush II application.</p><p><strong>Methods: </strong>The entire cornea and limbus of C57BL/6 mice were injured for 30-45 s, 60-75 s, 90-120 s, and 3-4 min. Photography and slit-lamp examination was performed on days 0, 2, 4, and 7, followed by hematoxylin & eosin, periodic acid-Schiff, and immunohistochemical staining. Statistical analysis was performed using one way ANOVA analysis.</p><p><strong>Results: </strong>A duration of 30-45 s of injury was found to be sufficient to induce superficial corneal and limbal epithelial debridement and re-epithelialization was completed in all eyes by day 7; however, clinical signs of LSCD were not observed in all mice. Increasing the exposure time to 90-120 s resulted in central 2+ corneal opacity with limbal and paracentral corneal neovascularization. All eyes injured for 3-4 min displayed clinical signs of LSCD, such as persistent epithelial defects on day 7 after the injury, central corneal neovascularization, and 2.2+ diffuse corneal opacity. Histological signs of LSCD, including goblet cell metaplasia and K13 expression on the corneal surface, were observed in all injured eyes.</p><p><strong>Conclusions: </strong>Our findings suggest that the duration of injury is an important factor influencing the severity of LSCD in a murine model of injury. A 1-mm rotating burr was found to be more effective for keratectomy and pigment release, whereas a 0.5-mm burr was more suitable for corneal epithelial debridement.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"256-265"},"PeriodicalIF":2.2,"publicationDate":"2023-11-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784216/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466190","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-11-01eCollection Date: 2023-01-01
Jingling Xu, Yihan Zheng, Lulu Cheng, Huihui Sun, Xinping Yu, Feng Gu, E Song
{"title":"<i>GPR143</i> mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.","authors":"Jingling Xu, Yihan Zheng, Lulu Cheng, Huihui Sun, Xinping Yu, Feng Gu, E Song","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. <i>GPR143</i> is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.</p><p><strong>Methods: </strong>A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of <i>GPR143</i>. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.</p><p><strong>Results: </strong>Genetic analysis identified 11 <i>GPR143</i> mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a <i>GPR143</i> mutation were found to present a typical or atypical phenotype of OA1. All patients with <i>GPR143</i> mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.</p><p><strong>Conclusions: </strong>We discovered seven novel mutations and four previously reported mutations of <i>GPR143</i> in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"234-244"},"PeriodicalIF":2.2,"publicationDate":"2023-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784212/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139465935","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Molecular VisionPub Date : 2023-10-25eCollection Date: 2023-01-01
Senem Cevik, Nutsuchar Wangtiraumnuay, Kristof Van Schelvergem, Mai Tsukikawa, Jenina Capasso, Subhasis B Biswas, Barry Bodt, Alex V Levin, Esther Biswas-Fiss
{"title":"Protein modeling and in silico analysis to assess pathogenicity of <i>ABCA4</i> variants in patients with inherited retinal disease.","authors":"Senem Cevik, Nutsuchar Wangtiraumnuay, Kristof Van Schelvergem, Mai Tsukikawa, Jenina Capasso, Subhasis B Biswas, Barry Bodt, Alex V Levin, Esther Biswas-Fiss","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The retina-specific ABCA transporter, ABCA4, plays an essential role in translocating retinoids required by the visual cycle. <i>ABCA4</i> genetic variants are known to cause a wide range of inherited retinal disorders, including Stargardt disease and cone-rod dystrophy. More than 1,400 <i>ABCA4</i> missense variants have been identified; however, more than half of these remain variants of uncertain significance (VUS). The purpose of this study was to employ a predictive strategy to assess the pathogenicity of <i>ABCA4</i> variants in inherited retinal diseases using protein modeling and computational approaches.</p><p><strong>Methods: </strong>We studied 13 clinically well-defined patients with <i>ABCA4</i> retinopathies and identified the presence of 10 missense variants, including one novel variant in the <i>ABCA4</i> gene, by next-generation sequencing (NGS). All variants were structurally analyzed using AlphaFold2 models and existing experimental structures of human ABCA4 protein. The results of these analyses were compared with patient clinical presentations to test the effectiveness of the methods employed in predicting variant pathogenicity.</p><p><strong>Results: </strong>We conducted a phenotype-genotype comparison of 13 genetically and phenotypically well-defined retinal disease patients. The in silico protein structure analyses we employed successfully detected the deleterious effect of missense variants found in this affected patient cohort. Our study provides American College of Medical Genetics and Genomics (ACMG)-defined supporting evidence of the pathogenicity of nine missense <i>ABCA4</i> variants, aligning with the observed clinical phenotypes in this cohort.</p><p><strong>Conclusions: </strong>In this report, we describe a systematic approach to predicting the pathogenicity of <i>ABCA4</i> variants by means of three-dimensional (3D) protein modeling and in silico structure analysis. Our results demonstrate concordance between disease severity and structural changes in protein models induced by genetic variations. Furthermore, the present study suggests that in silico protein structure analysis can be used as a predictor of pathogenicity and may facilitate the assessment of genetic VUS.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"217-233"},"PeriodicalIF":2.2,"publicationDate":"2023-10-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784225/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466381","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}