Molecular medicine reports最新文献

{"title":"Oroxylin A, a broad‑spectrum anticancer agent, relieves monocrotaline‑induced pulmonary arterial hypertension by inhibiting the Warburg effect in rats.","authors":"Yan Wang, Yamin Fan, Yanzi Zhou, Tianwang Chen, Shangfu Xu, Juan Liu, Lisheng Li","doi":"10.3892/mmr.2024.13319","DOIUrl":"10.3892/mmr.2024.13319","url":null,"abstract":"<p><p>Pulmonary arterial hypertension (PAH) is a chronic and fatal disease characterized by pulmonary vascular remodeling, similar to the 'Warburg effect' observed in cancer, which is caused by reprogramming of glucose metabolism. Oroxylin A (OA), an active compound derived from <i>Scutellaria baicalensis</i>, which can inhibit glycolytic enzymes [hexokinase 2 (HK2), Lactate dehydrogenase (LDH), and pyruvate dehydrogenase kinase 1 (PDK1) by downregulating aerobic glycolysis to achieve the treatment of liver cancer. To the best of our knowledge, however, the impact of OA on PAH has not been addressed. Consequently, the present study aimed to evaluate the potential protective role and mechanism of OA against PAH induced by monocrotaline (MCT; 55 mg/kg). The mean pulmonary artery pressure (mPAP) was measured using the central venous catheter method; HE and Masson staining were used to observe pulmonary artery remodeling. Non‑targeted metabolomics was used to analyze the metabolic pathways and pathway metabolites in MCT‑PAH rats. Western Blot analysis was employed to assess the levels of glucose transporter 1 (Glut1), HK2), pyruvate kinase (PK), isocitrate dehydrogenase 2 (IDH2), pyruvate dehydrogenase kinase 1(PDK1), and lactate dehydrogenase (LDH) protein expression in both lung tissue samples from MCT‑PAH rats. The results demonstrated that intragastric administration of OA (40 and 80 mg/kg) significantly decreased mPAP from 43.61±1.88 mmHg in PAH model rats to 26.51±1.53 mmHg and relieve pulmonary artery remodeling. Untargeted metabolomic analysis and multivariate analysis indicated abnormal glucose metabolic pattern in PAH model rats, consistent with the Warburg effect. OA administration decreased this effect on the abnormal glucose metabolism. The protein levels of key enzymes involved in glucose metabolism were evaluated by western blotting, which demonstrated that OA could improve aerobic glycolysis and inhibit PAH by decreasing the protein levels of Glut1, HK2, LDH, PDK1 and increasing the protein levels of PK and IDH2. In conclusion, OA decreased MCT‑induced PAH in rats by reducing the Warburg effect.</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 5","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11391512/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142109616","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Retracted] miR‑218 functions as a tumor suppressor gene in cervical cancer.","authors":"Zhen Liu, Lin Mao, Linlin Wang, Hong Zhang, Xiaoxia Hu","doi":"10.3892/mmr.2024.13326","DOIUrl":"https://doi.org/10.3892/mmr.2024.13326","url":null,"abstract":"<p><p>Following the publication of this paper, it was drawn to the Editor's attention by a concerned reader that, concerning the Transwell cell migration and invasion assays shown in Fig. 4Ba and 4Ca on p. 215, quite a large number of the data panels contained overlapping sections, such that data panels which were intended to show the results from differently performed experiments had been derived from a smaller number of original sources. After having considered this matter, in view of the number of overlapping data panels that were identified, the Editor of <i>Molecular Medicine Reports</i> has decided that this paper should be retracted from the Journal on account of a lack of confidence in the presented data. The authors were asked for an explanation to account for these concerns, but the Editorial Office did not receive a reply. The Editor apologizes to the readership for any inconvenience caused. [Molecular Medicine Reports 21: 209-219, 2020; DOI: 10.3892/mmr.2019.10809].</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 5","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11413840/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142291511","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Tanshinone IIA promotes osteogenic differentiation potential and suppresses adipogenic differentiation potential of bone marrow mesenchymal stem cells.","authors":"Wei Wang, Hangqin Wu, Shujing Feng, Xingrui Huang, Hao Xu, Xinxin Shen, Yajing Fu, Shuchen Fang","doi":"10.3892/mmr.2024.13301","DOIUrl":"10.3892/mmr.2024.13301","url":null,"abstract":"<p><p>Tanshinone IIA (Tan IIA) may have therapeutic effects on avascular necrosis of the femoral head (ANFH) by targeting bone marrow mesenchymal stem cells (BMSCs). The effect and underlying mechanism of Tan IIA on adipogenesis and osteogenesis ability of BMSCs remain to be elucidated. In the present study BMSCs were treated with osteogenic or adipogenic differentiation medium with or without Tan IIA under hypoxic environment. Osteogenic differentiation potential was evaluated by alkaline phosphatase (ALP) measurement, alizarin red staining and reverse transcription‑quantitative (RT‑q) PCR of osteogenic marker genes. Adipogenic differentiation potential was evaluated with oil red staining and RT‑qPCR of adipogenic marker genes. Detailed mechanism was explored by RNA‑seq and small molecular treatment during osteogenesis and adipogenesis of BMSCs. ALP level, mineralized nodules and expression level of osteogenic marker genes significantly increased following Tan IIA treatment during osteogenic differentiation of BMSCs. Lipid droplet and expression levels of adipogenic marker genes significantly decreased following Tan IIA treatment during adipogenic differentiation of BMSCs. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses of RNA‑seq data indicated increased Akt and TGFβ signaling following Tan IIA treatment. Further western blot assay confirmed that Tan IIA significantly activated Akt/cAMP response element‑binding protein signaling and TGFβ/Smad3 signaling. Application of Akti1/2 (an Akt inhibitor) significantly decreased the promotion effect of osteogenesis induced by Tan IIA, while the addition of SB431542 significantly reduced inhibition effect of adipogenesis caused by Tan IIA. Tan IIA could promote osteogenic differentiation potential of BMSCs by activating AKT signaling and suppress adipogenic differentiation potential of BMSCs by activating TGFβ signaling.</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11332326/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141917167","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Role of NOX1 and NOX5 in protein kinase C/reactive oxygen species‑mediated MMP‑9 activation and invasion in MCF‑7 breast cancer cells.","authors":"Hyun-Kyung Song, Jeong-Mi Kim, Eun-Mi Noh, Hyun Jo Youn, Young-Rae Lee","doi":"10.3892/mmr.2024.13312","DOIUrl":"10.3892/mmr.2024.13312","url":null,"abstract":"<p><p>NADPH oxidases (NOXs) are a family of membrane proteins responsible for intracellular reactive oxygen species (ROS) generation by facilitating electron transfer across biological membranes. Despite the established activation of NOXs by protein kinase C (PKC), the precise mechanism through which PKC triggers NOX activation during breast cancer invasion remains unclear. The present study aimed to investigate the role of NOX1 and NOX5 in the invasion of MCF‑7 human breast cancer cells. The expression and activity of NOXs and matrix metalloprotease (MMP)‑9 were assessed by reverse transcription‑quantitative PCR and western blotting, and the activity of MMP‑9 was monitored using zymography. Cellular invasion was assessed using the Matrigel invasion assay, whereas ROS levels were quantified using a FACSCalibur flow cytometer. The findings suggested that NOX1 and NOX5 serve crucial roles in 12‑O‑tetradecanoylphorbol‑13‑acetate (TPA)‑induced MMP‑9 expression and invasion of MCF‑7 cells. Furthermore, a connection was established between PKC and the NOX1 and 5/ROS signaling pathways in mediating TPA‑induced MMP‑9 expression and cellular invasion. Notably, NOX inhibitors (diphenyleneiodonium chloride and apocynin) significantly attenuated TPA‑induced MMP‑9 expression and invasion in MCF‑7 cells. NOX1‑ and NOX5‑specific small interfering RNAs attenuated TPA‑induced MMP‑9 expression and cellular invasion. In addition, knockdown of NOX1 and NOX5 suppressed TPA‑induced ROS levels. Furthermore, a PKC inhibitor (GF109203X) suppressed TPA‑induced intracellular ROS levels, MMP‑9 expression and NOX activity in MCF‑7 cells. Therefore, NOX1 and NOX5 may serve crucial roles in TPA‑induced MMP‑9 expression and invasion of MCF‑7 breast cancer cells. Furthermore, the present study indicated that TPA‑induced MMP‑9 expression and cellular invasion were mediated through PKC, thus linking the NOX1 and 5/ROS signaling pathways. These findings offer novel insights into the potential mechanisms underlying their anti‑invasive effects in breast cancer.</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11350630/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142109611","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis.","authors":"Jin Xu, Nan Sang, Junning Zhao, Wei He, Nannan Zhang, Xueliang Li","doi":"10.3892/mmr.2024.13307","DOIUrl":"10.3892/mmr.2024.13307","url":null,"abstract":"<p><p>Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR‑670‑5p and miR‑545‑3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of <i>Molecular Medicine Reports</i> for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11350621/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142000345","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Protective effects of fermented <i>Rosa roxburghii Tratt</i> juice against ethanol‑induced hepatocyte injury by regulating the NRF2‑AMPK signaling pathway in AML‑12 cells.","authors":"Lalai Zikela, Zhuoli Yu, Jindan Han, Huilin Zhu, Dingli Wang, Xuezhu Wang, Songtao Li, Qiang Han","doi":"10.3892/mmr.2024.13298","DOIUrl":"10.3892/mmr.2024.13298","url":null,"abstract":"<p><p>Alcohol‑related liver disease (ALD) is a major health concern worldwide. In recent years, there has been growing interest in natural products and functional foods for preventing and treating ALD due to their potential antioxidant and hepatoprotective properties. <i>Rosa roxburghii Tratt</i>, known for its rich content of bioactive compounds, has demonstrated promising health benefits, including anti‑inflammatory and antioxidant effects. Fermentation has been utilized as a strategy to enhance the bioavailability and efficacy of natural products. In the present study, using a mixture of <i>Rosa roxburghii Tratt juice</i>, lotus leaf extract and grape seed proanthocyanidins fermented by <i>Lactobacillus plantarum</i> HH‑LP56, a novel fermented <i>Rosa roxburghii Tratt</i> (FRRT) juice was discovered that can prevent and regulate ethanol‑induced liver cell damage. Following fermentation, the pH was significantly decreased, and the content of VC and superoxide dismutase (SOD) were significantly increased, along with a noticeable enhancement in hydroxyl and 2,2‑diphenyl‑1‑picrylhydrazyl free radical scavenging abilities. Alpha Mouse liver 12 cells were exposed to ethanol for 24 h to establish an <i>in vitro</i> liver cell injury model. The present study evaluated the effects of FRRT on cell damage, lipid accumulation and oxidative stress markers. The results revealed that FRRT pretreatment (cells were pre‑treated with 2.5 and 5 mg/ml FRRT for 2 h) significantly reduced lipid accumulation and oxidative stress in liver cells. Mechanistically, FRRT regulated lipid metabolism by influencing key genes and proteins, such as AMP‑activated protein kinase, sterol regulatory element binding transcription factor 1 and Stearyl‑CoA desaturase‑1. Furthermore, FRRT enhanced antioxidant activity by increasing SOD activity, glutathione and catalase levels, while reducing reactive oxygen species and malondialdehyde levels. It also reversed the expression changes of ethanol‑induced oxidative stress‑related genes and proteins. In conclusion, a novel functional food ingredient may have been discovered with extensive potential applications. These findings indicated that FRRT has antioxidant properties and potential therapeutic benefits in addressing ethanol‑induced liver cell damage through its effects on liver lipid metabolism and oxidative stress.</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11332318/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141875333","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Retracted] Downregulated expression levels of USP46 promote the resistance of ovarian cancer to cisplatin and are regulated by PUM2.","authors":"Lei Xu, Bin Zhang, Wenlan Li","doi":"10.3892/mmr.2024.13297","DOIUrl":"10.3892/mmr.2024.13297","url":null,"abstract":"<p><p>Following the publication of this paper, it was drawn to the Editor's attention by a concerned reader that certain of the immunohistochemical data shown in Fig. 1D and the flow cytometric data in Fig. 3K were strikingly similar to data appearing in different form in other papers by different authors at different research institutes that were under consideration for publication at around the same time.  Owing to the fact that the contentious data in the above article were already under consideration for publication prior to its submission to <i>Molecular Medicine Reports</i>, the Editor has decided that this paper should be retracted from the Journal. The authors were asked for an explanation to account for these concerns, but the Editorial Office did not receive a reply. The Editor apologizes to the readership for any inconvenience caused. [Molecular Medicine Reports 23: 263, 2021; DOI: 10.3892/mmr.2021.11902].</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11304133/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141875332","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Role of pyruvate kinase M2 in regulating sepsis (Review).","authors":"Yifei Hu, Jing Tang, Qiao Xu, Zenghui Fang, Rongqing Li, Mengxuan Yang, Jie Zhao, Xin Chen","doi":"10.3892/mmr.2024.13309","DOIUrl":"10.3892/mmr.2024.13309","url":null,"abstract":"<p><p>Glycolysis occurs in all living organisms as a form of energy supply. Pyruvate kinase M2 (PKM2) is one of the rate‑limiting enzymes in the glycolytic process. PKM2 is considered to serve an important role in several terminal diseases, including sepsis. However, to the best of our knowledge, the specific mechanistic role of PKM2 in sepsis remains to be systematically summarised. Therefore, the present review aims to summarise the roles of PKM2 in sepsis progression. In addition, potential treatment strategies for patients with sepsis are discussed. The present review hopes to lay the groundwork for studying the role of PKM2 and developing therapeutic strategies against metabolic disorders that occur during sepsis.</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11350625/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142000349","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Chitinase‑3 like‑protein‑1: A potential predictor of cardiovascular disease (Review).","authors":"Zhuojian Qu, Yirui Lu, Yutong Ran, Donghua Xu, Zhiliang Guo, Min Cheng","doi":"10.3892/mmr.2024.13300","DOIUrl":"10.3892/mmr.2024.13300","url":null,"abstract":"<p><p>Chitinase‑3 like‑protein‑1 (CHI3L1), a glycoprotein belonging to the glycoside hydrolase family 18, binds to chitin; however, this protein lacks chitinase activity. Although CHI3L1 is not an enzyme capable of degrading chitin, it plays significant roles in abnormal glucose and lipid metabolism, indicating its involvement in metabolic disorders. In addition, CHI3L1 is considered a key player in inflammatory diseases, with clinical data suggesting its potential as a predictor of cardiovascular disease. CHI3L1 regulates the inflammatory response of various cell types, including macrophages, vascular smooth muscle cells and fibroblasts. In addition, CHI3L1 participates in vascular remodeling and fibrosis, contributing to the pathogenesis of cardiovascular disease. At present, research is focused on elucidating the role of CHI3L1 in cardiovascular disease. The present systematic review was conducted to comprehensively evaluate the effects of CHI3L1 on cardiovascular cells, and determine the potential implications in the occurrence and progression of cardiovascular disease. The present study may further the understanding of the involvement of CHI3L1 in cardiovascular pathology, demonstrating its potential as a therapeutic target or biomarker in the management of cardiovascular disease.</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11332322/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141917165","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Crosstalk of methylation and tamoxifen in breast cancer (Review).","authors":"Jin Shen, Yan He, Shengpeng Li, Huimin Chen","doi":"10.3892/mmr.2024.13304","DOIUrl":"10.3892/mmr.2024.13304","url":null,"abstract":"<p><p>Tamoxifen is a widely used anti‑estrogen drug in the endocrine therapy of breast cancer (BC). It blocks estrogen signaling by competitively binding to estrogen receptor α (ERα), thereby inhibiting the growth of BC cells. However, with the long‑term application of tamoxifen, a subset of patients with BC have shown resistance to tamoxifen, which leads to low overall survival and progression‑free survival. The molecular mechanism of resistance is mainly due to downregulation of ERα expression and abnormal activation of the PI3K/AKT/mTOR signaling pathway. Moreover, the downregulation of targeted gene expression mediated by DNA methylation is an important regulatory mode to control protein expression. In the present review, methylation and tamoxifen are briefly introduced, followed by a focus on the effect of methylation on tamoxifen resistance and sensitivity. Finally, the clinical application of methylation for tamoxifen is described, including its use as a prognostic indicator. Finally, it is hypothesized that when methylation is used in combination with tamoxifen, it could recover the resistance of tamoxifen.</p>","PeriodicalId":18818,"journal":{"name":"Molecular medicine reports","volume":"30 4","pages":""},"PeriodicalIF":3.4,"publicationDate":"2024-10-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11338244/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141917166","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}