Journal of environmental biology最新文献

{"title":"New distribution records of the endemic pitcher plant, Nepenthes khasiana Hook. f. and identification of threats in Meghalaya, India","authors":"A. Bhattacharya, S. G. Momin, P. Sarkar","doi":"10.22438/jeb/45/1/mrn-5172","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5172","url":null,"abstract":"Aim: The present study entails new distribution records along with the identification of threats to the pitcher plant, Nepenthes khasiana Hook. f. in Meghalaya, India. Methodology: A trail survey was employed to find the distribution of pitcher plants in different locations of the Garo, Khasi, and Jaintia hills of Meghalaya between 2018 and 2022. Results: The present study reported some new distribution records in the Garo, Jaintia, and Khasi Hills of Meghalaya mostly in private lands which are scatteredly distributed. They are adversely threatened due to large-scale jhum cultivation, mining, traffic, road construction, human pressure, and tourism as depicted in the present study. Besides, the pitcher plants have been wiped out from many areas of Meghalaya which was earlier reported. Interpretation: The present work documented the distribution of pitcher plants in some new areas of the Garo, Khasi, and Jaintia Hills of Meghalaya. The population of the pitcher plant is sharply declining in Meghalaya due to various threat factors. Hence, the conservation of pitcher plant need urgent attention. Therefore, an action plan is required to safeguard the pitcher plant in these habitats. Besides public awareness, stakeholder participation is the paramount need of the hour to protect and preserve the plants. Further, new areas also need to be explored for the distribution of pitcher plants in other areas of the state including intensive studies in Garo, Khasi and Jaintia Hills. Key words: Carnivorous plants, Endemic, Meghalaya, Nepenthes khasiana, Pitcher plant","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"70 5","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139452706","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Cepacian degrading Cytobacillus sp. strain Dbc1 with anti-biofilm activity potentiating antibiotic efficacy against Burkholderia cepacia biofilm development","authors":"D. Ghosh, M. Seth, P. Mondal, S.K. Mukhopadhyay","doi":"10.22438/jeb/45/1/mrn-5165","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5165","url":null,"abstract":"Aim: Inhibition of biofilm formation in Burkholderia cepacia through enzymatic degradation of predominant exopolysaccharide (cepacian) of B. cepacia. Methodology: Cepacian was extracted from B. cepacia followed by isolation and identification of potent cepacian utilizing bacteria based on planktonic growth using cepacian as sole carbon source. Effective lyase activity (responsible for cepacian breakdown) and anti-biofilm activity of potent isolate against B. cepacia was determined. Effect of biofilm disintegration on antibiotic penetration into biofilm was detected. Lastly, inhibition of biofilm formation by crude lyase preparation of the isolate inside an external medical device was detected. Results: Cytobacillus sp. strain Dbc1 was the most potent cepacian degrading bacteria which showed significant lyase activity and reduced total biomass of both newly formed and pre-formed biofilm of B. cepacia. Cepacian degradation potentiated chloramphenicol penetration within pre-formed biofilm leading to cell mortality in B. cepacia. Cytobacillus sp. strain Dbc1significantly reduced total biomass of established biofilm inside nasal oxygen catheter. Interpretation: It can be concluded that Cytobacillus sp. strain Dbc1 significantly controlled mature B. cepacia biofilm through potent cepacian degrading and anti-biofilm activity along with better antibiotic targeting into established biofilm. Strain Dbc1 can be used to inhibit medical device- associated biofilms in vitro. Key words: Antibiotic susceptibility, Biofilm inhibition, Burkholderia cepacia, Cepacian breakdown, Multi-drug resistance","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"67 7","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139452793","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Response of spring maize to irrigation scheduling and mulching in Punjab","authors":"T. Singh, MS. Barkha, G. Kumari, K. Bokado","doi":"10.22438/jeb/45/1/mrn-5159","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5159","url":null,"abstract":"Aim: This study was planned and conducted to find the optimum IW:CPE level of irrigation scheduling along with mulching for spring maize in Punjab. Methodology: An experiment was conducted in spring, 2022 on agriculture farm of Lovely Professional University, Punjab comprising of four levels of irrigation scheduling viz., I1 (Surface irrigation at critical growth stages), I2 (Surface irrigation at 1.0 IW:CPE), I3 (Surface irrigation at 0.8 IW:CPE), I4 (Surface irrigation at 0.6 IW:CPE) assigned to main plots and two mulching treatments viz., M1 (No Mulch), M2 (With Mulch) allotted to the sub plots, which were replicated 4 times in split plot design. Results: Application of irrigation at IW:CPE ratio of 1.0 and 0.8 in spring maize were equally good as they recorded higher growth and yield parameters. Among the mulching practices, M2 resulted in better growth and yield parameters over no mulching. Highest green cob yield, grain yield and stover yield were also attained under irrigation applied at 1.0 IW:CPE combined with mulching, but it remained statistically at par with irrigation at 0.8 IW:CPE with mulching. Highest water use efficiency was seen under 0.8 IW:CPE. Interpretation: Optimum level of irrigation along with mulching for spring maize was assessed based on the results obtained for growth, yield as well as water use efficiency. It was recorded that irrigation at 0.8 IW:CPE with mulching was found best for higher grain yield of maize hybrid. Key words: Grain yield, Hybrid maize, Irrigation scheduling, Mulching, Water use efficiency","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"15 2","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139389958","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Fatty acid profiling of almond germpalsm grown in the Western Himalayan region of India","authors":"K. Kumawat, M.K. Verma, D. Kumar, D.B. Singh, S. Lal, J.I. Mir, O.C. Sharma, W.H. Raja, L. Chand","doi":"10.22438/jeb/45/1/mrn-5168","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5168","url":null,"abstract":"Aim: Nutritional profiling of almond genetic resources for their utilization and further use in the breeding programme. Methodology: The nuts of 32 almond genotypes were collected from the experimental farm of ICAR-CITH, Srinagar. Using a Soxhlet fat apparatus and 100ml of petroleum ether as a solvent, almond oil was extracted from 5 g of ground kernel. The fatty acid content of almond oil was analyzed by GC 30 (Perkin Elmer Autosystem XL) equipped with a CP-Wax 52 CB column (Varian Inc.) (50 x 0.25 mm, 0.2 μm). Results: The total oil content in these genotypes ranged between 41.82% (CITH-A-21) and 51.86% (Waris). The major fatty acids found were oleic acid (53.70-80.81%), linoleic acid (11.63-36.88%), and palmitic acid (5.19-8.13%). Stearic acid (1.01-2.53%) was estimated at a lower proportion, while α-linolenic acid was found in trace amounts (0.05-0.18%). The oleic: linoleic acid ratio varied from 1.46 (CITH-A-21) to 6.95 (CITH-A-06), conversely the highest (115.42) and lowest (93.96) iodine values were recorded in CITH-A-21 and CITH-A-06, respectively. The lowest content of saturated fatty acids (6.32%) and the highest content of unsaturated fatty acids (93.69%) were found in CITH-A-17 whereas contrasting results were observed in Nonpareil. The highest monounsaturated fatty acids (80.81%) and lowest polyunsaturated fatty acids (11.71%) were found in CITH-A-6. Oleic acid content was negatively correlated with linoleic acid (r = -1.00), palmitic acid (r = -0.67) and stearic acid (r = -0.68). Principal component analysis indicated that among the fatty acids, the oleic acid, linoleic acid, and Oleic/Linoleic ratio were largely responsible for the separation on the PC 1. Among the different almond genotypes, CITH-A-17 and CITH-A-06 were found to be promising in terms of fatty acid composition. Interpretation: The present study identified the genotypes with a high Oleic/Linoleic acid ratio, which is important for crop improvement programme and commercialization of these genotypes. Further, the present study also confirms that the Kashmir region is suitable for growing almonds with fatty acids composition at par with commercial almond cultivars grown in major almond-growing countries in the world. Key words: Almond, Breeding programme, Fatty acid profile, Germplasm, Oil content","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"102 43","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139391073","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Chitosan extracted from Portunus sanguinolentus (three-spot swimming crab) shells: its physico-chemical and biological potentials","authors":"J. Pradhan, B. Baisakhi, B.K. Das, K. Jena, S. Ananta, D. Mohanty","doi":"10.22438/jeb/45/1/mrn-5186","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5186","url":null,"abstract":"Aim: To summarize the extraction, physio-chemical, antibacterial and antioxidant properties of extracted chitosan from the exoskeleton of three-spot swimming crab, Portunus sanguinolentus as compared to commercial chitosan. Methodology: Chitosan biopolymer was extracted through demineralisation, deproteinization and deacetylation. The physico-chemical characterization of the extracted chitosan was carried out using Fourier Transforms Infrared Spectroscopy (FTIR), Field Emission Scanning Electron Microscopy (FESEM), X-Ray Diffraction (XRD), Thermogravimetric analysis (TGA) and Colorimetric analysis. Antibacterial activity using different concentrations of chitosan against Escherichia coli and Aeromonas hydrophila were tested by disc-diffusion method, while antioxidant activity was estimated by 1,1-diphenyl-2-picrylhydrazyl (DPPH) and H2O2 scavenging assay. Results: Crab chitosan (CC) showed the maximal zone of inhibition (17.00±0.50 and 15.16±0.577 mm), while commercial chitosan (CMC) showed 12.67±0.577 and 14.17±0.288 mm) against E. coli and A. hydrophila respectively. The scavenging potential of extracted chitosan ranged from 14 to 17% at different concentrations (0.05 to 0.2 mg ml-1). Crab chitosan efficiency to scavenge 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals varied from 7.2 to 12.98% at different concentrations (0.05 to 0.2 mg ml-1). Interpretation: Overall, the extracted chitosan exhibited properties to commercial chitosan, suggesting that it could be utilized as a dietary supplement in the fishery sector to protect against bacterial infections. This circular economy approach could significantly benefit sustainable waste management and environmental health. Key words: Antibacterial, Biopolymer, Chitosan, Crab, Portunus sanguinolentus","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"131 42","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139453382","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Removal of methylene blue azo dye from aqueous solution using biosorbent developed from floral waste","authors":"S. Agarwal, N. Rana, P. Bhardwaj, G.N. Tiwari, A.K. Yadav, M.C. Garg, A. Mathur, A. Tripathi","doi":"10.22438/jeb/45/1/mrn-5121","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5121","url":null,"abstract":"Aim: The present study was carried out to prepare biosorbent from temple floral waste (Tagetes erecta) by pyrolysis and chemical activation method for removal of methylene blue dye from aqueous solution. Methodology: Floral waste of Tagetes erecta collected from the temples were segregated, washed and dried to form biochar by direct pyrolysis and chemical activation method. Followed by physio-chemical analysis of biosorbents the most efficient biochar was selected for the removal of methylene blue dye from aqueous solution. The adsorbent efficiency and percentage removal of methylene blue dye was studied using various doses of biochar (10, 20, 30, 40, 50, 60, and 70 mg 100 ml-1,), effect of pH (2.0 to 4.0, 6.0 to 8.0, and 10.0 to 12.0) and effect of contact time etc. Results: The comparative physio-chemical analysis of the bio chars suggested that the activated charcoal made from temple flower waste by the direct pyrolysis method showed better performance, with its low moisture content (5.3%), low ash content (4.3%), higher yield, larger surface area, and higher porosity (65.3%) as compared to the biochar obtained from chemical activation. The percent adsorption significantly increased (p<0.05) from 76% to 87.0% on increasing biochar dose from 10.0 to 70.0 mg 100 ml-1. On increasing the pH of the solution from 4.0 to 6.0, Methylene blue removal significantly increased (p<0.05) from 88.0% to 91.0%. Interpretation: It is possible to manage floral waste from temples in a sustainable and environmentally responsible manner by converting it into biochar and using it for the treatment of waste water in order to eliminate hazardous dyes. Key words: Activated carbon, Azo dye, Bioremediation, Biochar, Floral waste, Methylene blue","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"17 12","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139452138","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Molecular identification of endosymbiotic bacteria associated with Ferrisia virgata (Homoptera: Coccoidea: Pseudococcidae) infesting cassava (Manihot esculenta)","authors":"B.G. Sangeetha, P. Drishya","doi":"10.22438/jeb/45/1/mrn-5170","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5170","url":null,"abstract":"Aim: To identify the mealy bug samples collected from cassava plants and identification of endosymbiotic bacteria associated with the mealy bugs Methodology: Molecular identification of mealy bugs was done using mitochondrial c y t o c h r o m e o x i d a s e ( C O X - 1 ) C 1 - J - 2 1 8 3 F(CAACATTTATTTTGATTTTTTGG) and CI-N-2568R (GCWACWACRTAATAKGTATCATG) primers. The molecular identification of bacteria was done using 16S rRNA gene universal primers Results: The mealy bug was identified as F. virgata and the endosymbionts associated with mealy bugs were identified as Lysinibacillus fusiformis and Bacillus cereus. Interpretation: The endosymbionts associated with the mealy bugs play significant role in completing lifecycle of insects host and for providing nutrients to the host insects. Key words: Cassava, Endosymbionts, Ferissia virgata, Mealybug","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"141 38","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139453066","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Metamorphosis of human health risk assessment with artificial intelligence (AI) - a new paradigm in pharmaco-toxicological sciences","authors":"S. V. S. Rana","doi":"10.22438/jeb/45/1/ed-3","DOIUrl":"https://doi.org/10.22438/jeb/45/1/ed-3","url":null,"abstract":"Toxicological Science, especially in the last five decades, has witnessed rapid evolution of different tools and techniques developed to address diverse issues related to studies dealing with adverse health effects of a variety of poisons, drugs, chemicals,ever-growing list of xenobiotics and human diseases. Traditionally these studies are performed using suitable animal (in vivo) models. There was a time when toxicologists/pharmacologists were searching models alternate to animal toxicity testing (Doke and Dhawale, 2015). Improved cell culture techniques, knowledge on stem cells and other microbiological systems led to the development of in vitro toxicology. It was soon followed by DNA chips, micro fluidics, in silico toxicology , toxicogenomics and computational toxicology. Several platforms are now discussing machine learning (ML) and artificial intelligence (AI) together as future tools of computational toxicology. For decades, quantitative structure-activity relationship (QSAR) methods have been employed to study the effects of drugs/chemicals (Cai et al., 2022). However, AI methods for toxicity assessment ranging from ADMEtox to AI4TOX provide evidence to the immense potential of AI. Intriguingly, a few problems between theoretical developments and practice of AI by end users have been recognized. AI is now being employed in cancer care. According to WHO (2022), cancer is responsible for 9.3 million deaths per year. AI is being used for cancer grading, classification, follow up services and diagnostic accuracy. However, certain limitations viz. testing, validation, certification and auditing need to be addressed (Cabral et al., (2023). Potential of AI in diabetic care and management has recently been recognized. The huge burden of diabetic patients in India can be managed through AI tools. Diabetic risk can be predicted using genomic data, to diagnose diabetes using EHR data and to identify diabetes related complications i.e. retinopathy and nephropathy (Singhla et al., 2019). Application of AI in the management of cardiovascular diseases like myocardial infarction has been highlighted with special reference to Chinese medicine (Chen et al., 2022). There exists experimental evidence that AI tools can be used to assess, monitor and manage Parkinsons' disease (Bounsall et al., 2023). Perspectives of the application of AI in complimentary and alternative medicine were reviewed by Chu et al. (2022). Several regulatory agencies are now adopting the concept of 3R ie., replacement, reduction and refinement of animal testing (EU REACH/3R principles; Toxicology 21 of U.S. Government) ( Maestri, 2021).The application of AI in clinical toxicology through converging data resources, algorithms, real world information from sensors and health records has also been discussed (Sinha et al. 2021). Plausibility of toxicity prediction using AI tools was recently reviewed by Santin et al. (2021). Application of AI in recently emerged science of nanotoxicology i","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"120 7","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139391517","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Root responses under water deficit stress: unraveling the impact on wheat crop and the ameliorating role of brassinolide","authors":"A.K. Sharma, J. Pradhan, S. Kumar, K. Pramanik, C. Kastury, G. Kumari, A. Jaiswal, C. Jena","doi":"10.22438/jeb/45/1/mrn-5169","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5169","url":null,"abstract":"Aim: To identify changes in root system architecture traits of wheat due to exogenous application of epibrassinolide for the alleviation of negative impact of low moisture stress in wheat crop. Methodology: On the basis of growth performances one set of contrasting wheat genotypes were identified (HD-2733, relatively stress tolerant and DBW-187 relatively stress sensitive). Similarly, brassinosteroids (BRs) concentration was selected by pilot experiments, wherein 0.01mM performed best among all. Taking all these results into consideration, four treatments (T0=well-watered, T1=water deficit, T3=EBL + well wateredandT4=EBL + water deficit) were maintained for evaluation of root architectural traits, biomassand grain yield per plant. Results: The tolerant genotype (HD-2733) showed better tolerance in almost all root traits and in yield as compared to the sensitive genotype (DBW-187). epibrassinolide under water deficit condition was found to be effective as the root trait values were higher for root length, root volume, root surface area and root biomass under EBL+ water deficit treatment as compared to water deficit. Shoot biomass was highly sensitive to water deficit as the biomass allocation under water deficit was more towards root as compared to shoot. Interpretation: Epibrassinolide can be a potent biochemical to improve the root characteristics as well as yield per plant. Seeds of tolerant genotype treated with 0.01m M EBL even under low moisture stress can be recommended. Key words: Epibrassinolide, Root system, Wheat, Water deficit","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"36 1","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139389705","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Comparative Analysis: Larvicidal efficacy of traditional Saudi Arabian herbs and boric acid against Aedes aegypti larvae, the Dengue fever vector","authors":"S. E. Sharawi","doi":"10.22438/jeb/45/1/mrn-5178","DOIUrl":"https://doi.org/10.22438/jeb/45/1/mrn-5178","url":null,"abstract":"Aim: This study evaluates the larvicidal properties of traditional Saudi Arabian herbs compared to Boric acid against the Aedes aegypti larval stage. Methodology: An evaluation of the larvicidal activity of eight plant extracts, as well as Boric acid, was conducted with Ae. aegypti larvae in the 3rd and 4th larval stages. Through stereo-dissecting microscope, morphological and death defects in larvae treated with Boric acid were documented. Results: The results showed that the mortality rates ranged from 59.3 to 98.3% at 30% concentration. Particularly noteworthy were Boric acid, M. chamomilla, and C. zeylanicum, demonstrating mortality rates of 100 to 89%, falling within the highly effective category. E. cardamomum, C. arabica, and A. sativum exhibited moderate efficacy (88 to 70%) whereas C. sinensis, P. nigrum and I. paraguariensis manifested relatively lower effectiveness (50 to 69%). Significantly, Boric acid showcased remarkable potency, inducing mortality rates of 28.3% even at an infinitesimal concentration of 1 ppm, accompanied by distinct malformation effects on treated larvae. These findings underscore the unparalleled larvicidal prowess of Boric acid, positioning it as a paramount choice for integrated mosquito control strategies. Interpretation: Furthermore, Boric acid accessibility, cost-effectiveness, and minimal impact on ecological systems and human health make it a compelling solution for mitigating Ae. aegypti populations, thereby fortifying our arsenal against mosquito-borne diseases. Key words: Aedes aegypti, Biological control, Boric acid, Plant extract","PeriodicalId":15688,"journal":{"name":"Journal of environmental biology","volume":"117 16","pages":""},"PeriodicalIF":0.7,"publicationDate":"2024-01-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139390951","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}