Molecular identification of endosymbiotic bacteria associated with Ferrisia virgata (Homoptera: Coccoidea: Pseudococcidae) infesting cassava (Manihot esculenta)

Abstract

Aim: To identify the mealy bug samples collected from cassava plants and identification of endosymbiotic bacteria associated with the mealy bugs Methodology: Molecular identification of mealy bugs was done using mitochondrial c y t o c h r o m e o x i d a s e ( C O X - 1 ) C 1 - J - 2 1 8 3 F(CAACATTTATTTTGATTTTTTGG) and CI-N-2568R (GCWACWACRTAATAKGTATCATG) primers. The molecular identification of bacteria was done using 16S rRNA gene universal primers Results: The mealy bug was identified as F. virgata and the endosymbionts associated with mealy bugs were identified as Lysinibacillus fusiformis and Bacillus cereus. Interpretation: The endosymbionts associated with the mealy bugs play significant role in completing lifecycle of insects host and for providing nutrients to the host insects. Key words: Cassava, Endosymbionts, Ferissia virgata, Mealybug