International Journal of Biosciences最新文献

{"title":"Biochemical composition of Philippine Mulberry (Morus spp.) fruits","authors":"","doi":"10.12692/ijb/22.4.165-174","DOIUrl":"https://doi.org/10.12692/ijb/22.4.165-174","url":null,"abstract":"","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"61 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-04-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"134986900","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"EFFECTS OF ORGANIC FERTILIZER TYPES AND DOSAGE ON BIOLOGICAL PROPERTIES OF SOIL, GROWTH AND PRODUCTS OF ONION (Allium ascalonicum L.) OUTSIDE THE PLANTING SEASON IN BUAHAN VILLAGE, BALI, INDONESIA","authors":"N. Kartini","doi":"10.24843/IJBB.2021.V08.I02.P02","DOIUrl":"https://doi.org/10.24843/IJBB.2021.V08.I02.P02","url":null,"abstract":"Planting shallots in Buahan Village is only carried out once a year, namely in July. The continuous use of synthetic fertilizers at high doses without being balanced with natural fertilizers has degraded the land so that soil fertility has decreased. The negative impact caused is a decrease in the yield of shallots. Quality organic fertilizers can overcome this problem. Organic vermicompost and biosllury fertilizers are quality organic fertilizers that can replace synthetic fertilizers to increase the growth and yield of shallots. The research objective was to determine the growth and yield of shallots by giving the type and dose of organic fertilizers outside the growing season. The research was conducted from March to July 2019 in Buahan Village, Kintamani District, Bangli Regency. The study used a simple randomized block design with one factor with 6 treatments, namely B0 (Without Organic Fertilizer), B1 (2000 kg / ha vermicompost); B2 (1000 L / ha biosllury) B3 (1000kg / ha vermicompost + 500 L / ha biosllury); B4 (4000 kg / ha vermicompost); B5 (2000 L / ha biosllry); B6 (2000kg / ha vermicompost + 1000 L / ha biosllury); B7 (4000 kg / ha vermicompost + 2000L biosllry) and B8 (5000 kg / ha vermicompost + 3000L / ha biosllury). The parameters observed were plant height, number of tillers, tuber wet weight per clump, harvest dry weight of tubers per clump and number of cloves per clump, soil pH, N-total (%), C-organic and total population of soil microorganisms. The results showed that the type and dose of organic fertilizer had a significant effect on all the meters observed. Treatment of 5000 kg / ha vermicompost + 3000L / ha biosllury gave the highest yield, namely 56.8 g per clump, 60% higher than the control 35.5 g per clump.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"3 1","pages":"6"},"PeriodicalIF":0.0,"publicationDate":"2021-05-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"74566518","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"PHYTOCHEMICAL ANALYSIS AND ANTIOXIDANT ACTIVITY OF PURNAJIWA FRUIT EXTRACT (Euchresta horsfieldii (Lesch.) Benn.)","authors":"Romulia Trielva Apriliani, I. Wirawan, Wayan Adiartayasa","doi":"10.24843/ijbb.2020.v08.i01.p04","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v08.i01.p04","url":null,"abstract":"Antioxidant is a chemical compound that could give one or more electrons to inhibit the free radical reaction. One of the plants that potentially produce antioxidants is purnajiwa (Euchresta horsfieldii (Lesch.) Benn.). The research was conducted using the fruit of purnajiwa. The purpose of this study is to know antioxidant activity from purnajiwa fruit using the DPPH method and measured by UV-Vis spectrophotometry. The extract of purnajiwa fruit gained by the maceration method using 96% ethanol solvent. The results of phytochemistry screening found out that the extract contains flavonoid, alkaloid, saponin, tannin, and terpenoid. According to flavonoid testing using quercetin, the results obtained from purnajiwa extract contained flavonoid of 1,651 mg QE/g. The activity test of antioxidants quantitatively by DPPH using UV-Vis spectrophotometry found out that purnajiwa extract has IC50 value of 57,28 ppm so that purnajiwa extract has strong antioxidant activity that could be used as natural antioxidant resources.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"1 1","pages":"31"},"PeriodicalIF":0.0,"publicationDate":"2020-11-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89848757","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Citrus TISSUE CULTURE WITH TWO DIFFERENT APPROACHES","authors":"F. Chamandoosti","doi":"10.24843/ijbb.2020.v08.i01.p03","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v08.i01.p03","url":null,"abstract":"Citrus is an important genius for economy and human health but a susceptible genius against biotic and abiotic stresses, so it needs to improved programs. Different basal media (MS, 1⁄2MA, 1⁄3MS and DKW) and different kind and concentrations of plant growth regulators i.e. BA, KIN, 2ip, ZE and TDZ (0 – 2 mg/l) and NAA, IAA and IBA (0 – 2 mg/l) added with 30 g/l sucrose, 3 g/l active charcoal and 7.5 g/l bacteriological agar] were used for organogenesis include shooting and rooting, also callusing from nodal explant of Citrus latifolia. MS medium supplemented with 1 mg/l BA, and 0.01 mg/l NAA is the best media for multiple shoot induction on nodal explants and elongation of them. Other cytokinins had not significant effects on shoot induction and multiplication. Using of 0.01 mg/l IBA instead of 0.01 mg/l NAA on medium with 1 mg/l BA, led to multiple shoot induction on nodal explant indirectly. Rooting was induced on DKW medium plus 1.5 mg/l NAA in the best way compared another media. Both direct and indirect organogenesis (multiple shoot induction) were carried out on media with very similar contents. So we can use very simple and practical methods tissue culture for different improved programs in Citrus genius genius.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"147 1","pages":"19"},"PeriodicalIF":0.0,"publicationDate":"2020-11-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"76330424","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"RUNNER-TIP CULTURE OF STRAWBERRY (Fragaria x ananassa Duch) GROWN ON SEVERAL SHOOT-INDUCTION MEDIUM","authors":"R. Dwiyani, Hestin Yuswanti, N. N. A. Mayadewi, Yuyun Fitriani","doi":"10.24843/ijbb.2020.v08.i01.p02","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v08.i01.p02","url":null,"abstract":"A research regarding “Runner-tip culture of strawberry (Fragaria x ananassa Duch) Grown on Several Shoot-induction Medium” has been investigated. The objective of the research was to find out the most suitable medium for shoot production from runner-tip culture of strawberry at establishment step of micropropagation. The research was laid out in a Completely Randomized Design, 4 treatments of medium type for shoot induction and 10 replication, each was represented by one (1) bottle with 6-8 explants. The treatments were summarized as follows: T1 = MS ; T2 = MS + 2 ppm BAP + 0.01 ppm NAA; T3 = MS + 1 ppm of TDZ; T4 = WPM + 2 ppm BAP + 0.01 ppm NAA. The parameters observed were days of the bud emergence, the average number of shoots per explant, and the average number of leaves per explant. It can be concluded that among medium used in the current research, the medium of MS added with 1 ppm thidiazuron (TDZ) was the most suitable medium for shoot production of strawberry from the explant of runner-tips. The treatment was resulted in the earliest time of bud emergence, and producing the highest number of shoots and leaves.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"6 1","pages":"10"},"PeriodicalIF":0.0,"publicationDate":"2020-11-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"85497101","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"TOXICITY TEST OF Gracilaria sp. AGAINST Aspergillus niger van Tieghem AND THE PHYTOCHEMICAL ANALYSIS","authors":"Nevy Widya Pangestika, I. Wirawan, I. K. Suada","doi":"10.24843/ijbb.2020.v08.i01.p01","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v08.i01.p01","url":null,"abstract":"The purpose of this study was to know the effectiveness of Gracilaria sp. ethanol extract to inhibit the growth of Aspergillus niger. The results showed that the ethanol extract of Gracilaria sp. was not effective to inhibit the growth of A. niger. The minimum inhibitory concentration test (MIC) was carried out using extracts with 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7 %, 0.8 %, 0.9%, 1%, 2% and 0% percentage. The MIC results showed that the minimum extract inhibiting A. niger was 0.8%. The results of the antifungal activity test showed that the ethanol extract of Gracilaria sp. was fungistatic against A. niger. On the third day incubation, the 4% extract inhibited the growth of fungi with an average diameter of 5 mm. The fungal colony test was carried out using extract with 0.5%, 1%, 2%, 4% and 0% concentration, and the results showed that extract with 4% concentration can inhibit fungi colony growth by 69%. Phytochemical analysis was conducted using the UV-Vis Spectrophotometry, and the results showed that the ethanol extract of Gracilaria sp. contained 366.33 mg/100g/GAE phenol, 2041.47 mg/100g flavonoids, and 3041.60 mg/100g/TAE tannins. Tannins are suspected to be the most dominant fungistatic compound with the largest amount.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"310 1","pages":"1"},"PeriodicalIF":0.0,"publicationDate":"2020-11-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"86765912","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"PRIMER DESIGN OF CVPDr DNA FRAGMENT SEQUENCES THAT AMPLIFY SPECIFIC FRAGMENTS TO DISTINCT THE RESISTANT FRAGMENT FROM Triphasia trifolia (Burm. F.) P. Wils. AND THE SUSCEPTIBLE FRAGMENT FROM Citrus nobilis Lour.","authors":"N. Utami, I. Wirawan, I. K. Suada","doi":"10.24843/ijbb.2020.v07.i02.p05","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v07.i02.p05","url":null,"abstract":"CVPD is a DNA fragment that indicates that plants are resistant to CVPD. Previous research using primers that amplified 841 bp CVPD fragment was able to amplify the fragment from Triphasia trifolia that considers being a resistant plant, Citrus aurantifolia var. seedless which considers being a tolerant plant, and some susceptible citrus plants to CVPD disease. In this study, we designed some primers that amplified only CVPD DNA fragment from T. trifolia which consider as the resistant plant and a primer that amplified only DNA fragmen from Citrus nobilis which consider as the susceptible citrus plants. The primers for CVPD on T. trifolia are TCATCTGCATGGGATACC for forward primer and GCCTTGAGCTTGTAAGTG for reverse primer which turned out to amplify the DNA of T. trifolia and also the C. nobilis cultivar Denpasar and only succeeded in not amplifying the C. nobilis cultivar Gianyar. The primers for CVPD on C. nobilis are GAATGGCTTAGCAGAAAGG for forward primer and GGTTGTAGATGGACATAGG for reverse primer turned out can not only amplify the DNA C. nobilis but also amplify T. trifolia.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"14 1","pages":"91"},"PeriodicalIF":0.0,"publicationDate":"2020-06-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"80397812","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"ANTIOXIDANT ACTIVITY OF THE TOPICAL PREPARATION OF BULUNG SANGU (Gracilaria spp) EXTRACT","authors":"M. M. Sasadara, I. Wirawan, M. Sritamin, I. K. Suada, Wayan Adiartayasa","doi":"10.24843/ijbb.2020.v07.i02.p04","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v07.i02.p04","url":null,"abstract":"Bulung Sangu (Gracilaria spp) as many other macroalgae, is a source of beneficial phytochemical for health. Phytochemicals in macroalgae are widely used as active ingredients in cosmetic preparations. The study was aimed to determine the antioxidant properties of Bulung Sangu formulated in topical preparation. Bulung Sangu was macerated in ethanol 96% following by extract formulation in cream preparation in two concentrations: 5% and 10%. Antioxidant activity was determined against DPPH radical, compared to ascorbic acid. Percentage of reducing power in five concentration series (10, 20, 30, 40, and 50 μm/ml) statistical analyzes using one-way ANOVA with 95% of confidence level, following by IC50 measurement. Absorbance was read in wavelength of 517 nm. Concentration of 5% and 10% cream extract exhibited IC50 of 13,091 μg/ml and 11,867 μg/ml, respectively. These values are lower than IC50 of ascorbic acid (18,505 μg/ml), indicating the strong antioxidant properties of Bulung Sangu extract cream which is more potential than ascorbic acid. Bulung Sangu exhibit a potential source for being developed as medicine and cosmetics in topical preparation.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"34 1","pages":"83"},"PeriodicalIF":0.0,"publicationDate":"2020-06-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84933057","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA","authors":"Ni Putu Merthaningsih, I. Sudiarta, G. Wirya","doi":"10.24843/ijbb.2020.v07.i02.p01","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v07.i02.p01","url":null,"abstract":"One of the pests of citrus is whitefly that causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"22 1","pages":"57"},"PeriodicalIF":0.0,"publicationDate":"2020-06-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78480700","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"MOLECULAR IDENTIFICATION OF FUNGI THE CAUSAL AGENT OF STRAWBERRY WILT DISEASE IN BALI","authors":"G. Wirya, I. W. D. Gargita, I. Sudiarta","doi":"10.24843/ijbb.2020.v07.i02.p02","DOIUrl":"https://doi.org/10.24843/ijbb.2020.v07.i02.p02","url":null,"abstract":"The development of strawberry farming in Bali experiencing some obstacles that cause a decline in production, such as wilting disease. The disease was reported caused by the fungi base on morphological recognition. There are two fungi were recognized caused the strawberry wilt disease in Bali, they are from genus Verticillium and Fusarium. More specific information about causal agent of wilt disease in strawberry especially in Bali is needed. The one accurate identification is done through the molecular approach by analyzing DNA that encode the ribosomal DNA (rDNA). The 18S rDNA, including the internal areas of transcribed spacers (ITS), ITS1 and ITS4 have been widely used in phylogenetic studies. The amplification results of this area produce bands in different sizes that can be used to identify fungal species. Based on that the identification of strawberry wilt disease using molecular analysis was conducted. The 542 bp of Internal Transcribed Spacer (ITS) DNA was successfully amplified using PCR with pairing primers ITS 1 (5TCCGTAGGTGAACCTGCGG-3’), and ITS 4 (5’-TCCTCCGCTTATTGATATGC-3’). The sequences of three isolates were successfully obtained through sequencing. Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Homology levels were tested between sequences and showed that Candi Kuning sequence and Gobleg sequence had 95% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. While Pancasari sequence have 94% similarity with sequence of Fusarium oxysporum NRRL 13307 (U34571) from America. Candi Kuning, Gobleg, and Pancasari sequences had the same 86% with sequence of Fusarium oxysporum isolate C34-294 Brazil (KJ439088) and had 89% similarity with sequence Fusarium oxysporum f.sp. fragariae China (KT833080). Based on phylogeny analysis of Pancasari, Gobleg and Candi Kuning isolates were obtained in one group with Fusarium oxysporum identified in America and Brazil, and also in one group with Fusarium oxysporum f. sp. fragariae that identified in China.","PeriodicalId":13776,"journal":{"name":"International Journal of Biosciences","volume":"31 1","pages":"64"},"PeriodicalIF":0.0,"publicationDate":"2020-06-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78964073","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}