中国当代儿科杂志最新文献

{"title":"[Clinical sub-phenotypes of acute kidney injury in children and their association with prognosis].","authors":"Lian Feng, Min Li, Zhen Jiang, Jiao Chen, Zhen-Jiang Bai, Xiao-Zhong Li, Guo-Ping Lu, Yan-Hong Li","doi":"10.7499/j.issn.1008-8830.2408060","DOIUrl":"10.7499/j.issn.1008-8830.2408060","url":null,"abstract":"<p><strong>Objectives: </strong>To investigate the clinical sub-phenotype (SP) of pediatric acute kidney injury (AKI) and their association with clinical outcomes.</p><p><strong>Methods: </strong>General status and initial values of laboratory markers within 24 hours after admission to the pediatric intensive care unit (PICU) were recorded for children with AKI in the derivation cohort (<i>n</i>=650) and the validation cohort (<i>n</i>=177). In the derivation cohort, a least absolute shrinkage and selection operator (LASSO) regression analysis was used to identify death-related indicators, and a two-step cluster analysis was employed to obtain the clinical SP of AKI. A logistic regression analysis was used to develop a parsimonious classifier model with simplified metrics, and the area under the curve (AUC) was used to assess the value of this model. This model was then applied to the validation cohort and the combined derivation and validation cohort. The association between SPs and clinical outcomes was analyzed with all children with AKI as subjects.</p><p><strong>Results: </strong>In the derivation cohort, two clinical SPs of AKI (SP1 and SP2) were identified by the two-step cluster analysis using the 20 variables screened by LASSO regression, namely SP_d1 group (<i>n</i>=536) and SP_d2 group (<i>n</i>=114). The simplified classifier model containing eight variables (<i>P</i><0.05) had an AUC of 0.965 in identifying the two clinical SPs of AKI (<i>P</i><0.001). The validation cohort was clustered into SP_v1 group (<i>n</i>=156) and SP_v2 group (<i>n</i>=21), and the combined derivation and validation cohort was clustered into SP1 group (<i>n</i>=694) and SP2 group (<i>n</i>=133). After adjustment for confounding factors, compared with the SP1 group, the SP2 group had significantly higher incidence rates of multiple organ dysfunction syndrome and death during the PICU stay (<i>P</i><0.001), and SP2 was significantly associated with the risk of death within 28 days after admission to the PICU (<i>P</i><0.001).</p><p><strong>Conclusions: </strong>This study establishes a parsimonious classifier model and identifies two clinical SPs of AKI with different clinical features and outcomes.The SP2 group has more severe disease and worse clinical prognosis.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"47-54"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750252/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013331","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Disease burden of communicable diseases among children and adolescents aged under 20 years in China from 1990 to 2021].","authors":"Yang Yang, Ming-Yi Zhao","doi":"10.7499/j.issn.1008-8830.2408082","DOIUrl":"10.7499/j.issn.1008-8830.2408082","url":null,"abstract":"<p><strong>Objectives: </strong>To investigate the epidemiological characteristics and changing trends of communicable diseases among children and adolescents in China from 1990 to 2021.</p><p><strong>Methods: </strong>Based on the Global Burden of Disease Database, epidemiological indicators for communicable diseases among the population aged under 20 years in China from 1990 to 2021 were selected to analyze the burden of communicable diseases in this population, and a comparative analysis was performed with global data as well as data from Western Europe and North America.</p><p><strong>Results: </strong>In 1990-2021, the overall burden of communicable diseases tended to decrease among children and adolescents in China. In 2021, the prevalence rate of communicable diseases in China was lower than the global prevalence rate and was higher than that in Western Europe and North America. There was a significant reduction in the mortality rate of communicable diseases, and the gap with Western Europe and North America gradually narrowed year by year. The overall incidence rate, mortality rate, and disability-adjusted life year rate of communicable diseases in males were higher than those in females, and respiratory infections and intestinal infections were more common in children aged <5 years, while the incidence rate of sexually transmitted diseases was higher in adolescents.</p><p><strong>Conclusions: </strong>From 1990 to 2021, the disease burden of communicable diseases among the population under 20 years old in China has significantly decreased. However, there is still a certain gap compared to developed regions. Strengthening the prevention and control of diseases such as respiratory infections and acquired immunodeficiency syndrome, as well as enhancing health interventions for children under 5 years old, will help improve the overall health level of children and adolescents in China.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"39-46"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750238/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013396","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Prognosis of bronchopulmonary dysplasia].","authors":"Ying-Zhen Zhou, Ting Wang, Xing-Meng Fu, Bing-Ming Peng, Zhou Fu","doi":"10.7499/j.issn.1008-8830.2406004","DOIUrl":"10.7499/j.issn.1008-8830.2406004","url":null,"abstract":"<p><p>Children with bronchopulmonary dysplasia (BPD) often exhibit severe respiratory problems and significant pulmonary dysfunction during school age and adulthood. Exercise tests show a decline in cardiopulmonary function and physical performance in children with BPD, who also have a higher incidence of pulmonary hypertension. These children generally perform poorly in terms of intelligence, language, and motor development. As they age, the risk of neurodevelopmental disorders increases, and health-related quality of life is also affected. This article reviews the prognosis of the respiratory system, physical capacity, cardiovascular system, nervous system, and health-related quality of life in children with BPD, aiming to improve the management of these patients and enhance their subsequent quality of life.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"115-120"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750241/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013459","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Interpretation of \"Expert recommendations for the prevention of common respiratory viral infections in neonates\": problems faced by respiratory syncytial virus infection in neonates].","authors":"Chen Cheng, Ya-Juan Wang, Yuan Shi","doi":"10.7499/j.issn.1008-8830.2409033","DOIUrl":"10.7499/j.issn.1008-8830.2409033","url":null,"abstract":"<p><p>Neonates are susceptible to respiratory viral infections, with outbreaks reported in areas with a high population of neonates, such as postpartum care centers and neonatal wards. While specific antiviral drugs are currently available for influenza, symptomatic supportive treatment remains the primary approach for respiratory syncytial virus (RSV), making prevention particularly important. The article closely follows the \"Expert recommendations for the prevention of common respiratory viral infections in neonates\" and provides an in-depth interpretation of recent breakthroughs in RSV prevention. It discusses the physiological and immunological characteristics of neonates, the disease burden and transmission routes of RSV infection, the main clinical manifestations and long-term effects of RSV infection in neonates, as well as specific preventive measures against RSV and practical recommendations and prevention experiences for RSV from abroad to lay a foundation for RSV prevention and control in neonates in China.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"26-32"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750237/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013452","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood].","authors":"Juan Ye, Feng Ye, Ling Hou, Wei Wu, Xiao-Ping Luo, Yan Liang","doi":"10.7499/j.issn.1008-8830.2408032","DOIUrl":"10.7499/j.issn.1008-8830.2408032","url":null,"abstract":"<p><strong>Objectives: </strong>To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.</p><p><strong>Methods: </strong>A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.</p><p><strong>Results: </strong>All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (<i>GCK</i>) gene, with Cases 6 (<i>GCK</i> c.1047C>A, p.Y349X), 11 (<i>GCK</i> c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (<i>GCK</i> c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.</p><p><strong>Conclusions: </strong>This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"94-100"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750243/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143012797","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Research advances in maturity-onset diabetes of the young].","authors":"Hui-Yun Geng, Zhi-Hua Wang","doi":"10.7499/j.issn.1008-8830.2408070","DOIUrl":"10.7499/j.issn.1008-8830.2408070","url":null,"abstract":"<p><p>Maturity-onset diabetes of the young (MODY) is a special type of diabetes characterized by clinical features including early onset of diabetes (before 30 years of age), autosomal dominant inheritance, impaired glucose-induced insulin secretion, and hyperglycemia. So far, 14 types of MODY have been reported, accounting for about 1%-5% of the patients with diabetes. MODY often presents with an insidious onset, and although 14 subtypes have been identified for MODY, it is frequently misdiagnosed as type 1 or type 2 diabetes due to overlapping clinical features and high costs and limitations of genetic testing. This article reviews the clinical features of MODY subtypes in order to improve the accuracy of the diagnosis and treatment of MODY.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"121-126"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750248/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013462","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Berberine ameliorates coronary artery endothelial cell injury in Kawasaki disease through complement and coagulation cascades].","authors":"Jin-Wen Liao, Xin Guo, Bo Liang, Xu-Xia Li, Ming-Guo Xu","doi":"10.7499/j.issn.1008-8830.2406075","DOIUrl":"10.7499/j.issn.1008-8830.2406075","url":null,"abstract":"<p><strong>Objectives: </strong>To explore the role of berberine (BBR) in ameliorating coronary endothelial cell injury in Kawasaki disease (KD) by regulating the complement and coagulation cascade.</p><p><strong>Methods: </strong>Human coronary artery endothelial cells (HCAEC) were divided into a healthy control group, a KD group, and a BBR treatment group (<i>n</i>=3 for each group). The healthy control group and KD group were supplemented with 15% serum from healthy children and KD patients, respectively, while the BBR treatment group received 15% serum from KD patients followed by the addition of 20 mmol/L BBR. Differential protein expression was analyzed and identified using isobaric tags for relative and absolute quantitation technology and liquid chromatography-tandem mass spectrometry, followed by GO functional enrichment analysis and KEGG signaling pathway enrichment analysis of the differential proteins. Western blot was used to detect differential protein expression.</p><p><strong>Results: </strong>A total of 518 differential proteins were identified between the KD group and the healthy control group (300 upregulated proteins and 218 downregulated proteins). A total of 422 differential proteins were identified between the BBR treatment group and the KD group (221 upregulated proteins and 201 downregulated proteins). Bioinformatics analysis showed that compared to the healthy control group, the differential proteins in the KD group were enriched in the complement and coagulation cascade and ribosome biogenesis in eukaryotes. Compared to the KD group, the differential proteins in the BBR treatment group were also enriched in the complement and coagulation cascade and ribosome biogenesis in eukaryotes. Western blot results indicated that compared to the healthy control group, the expression of complement C1q subcomponent subunit C (C1QC), kininogen-1 (KNG1), complement C1s subcomponent (C1S), and C4b-binding protein alpha chain (C4BPA) was increased in the KD group (<i>P</i><0.05). Compared to the KD group, the expression of KNG1, C1S, C1QC, and C4BPA was decreased in the BBR treatment group (<i>P</i><0.05).</p><p><strong>Conclusions: </strong>The complement and coagulation cascade may be involved in the regulation of BBR treatment for coronary injury in KD, and C1QC, KNG1, C1S, and C4BPA may serve as biomarkers for this treatment.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"101-108"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750244/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143012792","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Development of a predictive scoring model for non-response to intravenous immunoglobulin in Kawasaki disease].","authors":"Yi-Xu Huang, Yu Huang, Guang-Huan Pi","doi":"10.7499/j.issn.1008-8830.2408077","DOIUrl":"10.7499/j.issn.1008-8830.2408077","url":null,"abstract":"<p><strong>Objectives: </strong>To explore the predictive factors for non-response to intravenous immunoglobulin (IVIG) in children with Kawasaki disease (KD) and to establish an IVIG non-response prediction scoring model for the Sichuan region.</p><p><strong>Methods: </strong>A retrospective study was conducted by collecting clinical data from children with KD admitted to four tertiary hospitals in Sichuan Province between 2019 and 2023. Among them, 940 children responded to IVIG, while 74 children did not respond. Multivariate logistic regression analysis was used to identify the predictive factors for non-response to IVIG and to establish a predictive scoring model. The model's effectiveness was assessed using the receiver operating characteristic curve (ROC) and validated with an independent dataset.</p><p><strong>Results: </strong>Multivariate logistic regression analysis showed that the platelet-to-lymphocyte ratio (PLR), hemoglobin (Hb), serum creatinine, aspartate aminotransferase (AST), and platelet count (PLT) were closely related to non-response to IVIG in children with KD (<i>P</i><0.05). Based on these indicators, a predictive scoring model was established: PLR > 199, 0.4 points; Hb ≤ 116 g/L, 4 points; AST > 58 U/L, 0.2 points; serum creatinine > 38 µmol/L, 3.9 points; PLT count ≤ 275 × 10⁹/L, 0.3 points. Using this model, children with KD were scored, and a total score greater than 4.3 was considered high risk of non-response to IVIG. The sensitivity of the model in predicting non-response to IVIG was 77.0%, specificity was 65.7%, and the area under the ROC curve was 0.746 (95%<i>CI</i>: 0.688-0.805).</p><p><strong>Conclusions: </strong>The predictive scoring model based on PLR, Hb, serum creatinine, AST, and PLT demonstrates good predictive performance for non-response to IVIG in children with KD in the Sichuan region and can serve as a reference for clinical decision-making.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"75-81"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750246/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013395","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Clinical practice guidelines for the diagnosis and treatment of anemia of prematurity (2025)].","authors":"","doi":"10.7499/j.issn.1008-8830.2407094","DOIUrl":"10.7499/j.issn.1008-8830.2407094","url":null,"abstract":"<p><p>Anemia of prematurity (AOP) is a multifactorial condition associated with congenital iron deficiency, low erythropoietin levels, a short lifespan of red blood cells, and iatrogenic blood loss. AOP is a common complication in premature infants that can adversely affect growth, development, and long-term neurocognitive outcomes. To standardize the diagnosis and treatment of AOP, the Neonatal Clinical Practice Guidelines Expert Committee and the Neonatal Evidence-Based Medicine Group of the Commission of Neonatal Medicine of the Cross-Strait Medical and Health Exchange Association, along with the Editorial Office of the <i>Chinese Journal of Contemporary Pediatrics</i>, have developed the \"Clinical practice guidelines for the diagnosis and treatment of anemia of prematurity (2025)\", based on the World Health Organization's handbook for guideline development and the formulation/revision principles of Chinese clinical practice guidelines. This guideline addresses eight clinical issues related to AOP, including risk factors, early identification, etiological diagnosis, diagnostic criteria, early prevention, transfusion therapy, strategies to improve prognosis, and post-discharge follow-up. It presents 29 recommendations formed from current evidence and expert consensus, aiming to provide guidance and decision-making support for healthcare professionals in the diagnosis and treatment of AOP.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"1-17"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750247/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013246","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"[Explanation and interpretation of blood transfusion provisions for children with hematological diseases in the national health standard \"Guideline for pediatric transfusion\"].","authors":"Ming-Yi Zhao, Rong Huang, Rong Gui, Qing-Nan He, Ming-Yan Hei, Xiao-Fan Zhu, Jun Lu, Xiao-Jun Xu, Tian-Ming Yuan, Rong Zhang, Xu Wang, Jin-Ping Liu, Jing Wang, Zhi-Li Shao, Yong-Jian Guo, Xin-Yin Wu, Jia-Rui Chen, Qi-Rong Chen, Jia Guo, Ming-Hua Yang","doi":"10.7499/j.issn.1008-8830.2410093","DOIUrl":"10.7499/j.issn.1008-8830.2410093","url":null,"abstract":"<p><p>To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard \"Guideline for pediatric transfusion\" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the \"Guideline for pediatric transfusion\", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.</p>","PeriodicalId":39792,"journal":{"name":"中国当代儿科杂志","volume":"27 1","pages":"18-25"},"PeriodicalIF":0.0,"publicationDate":"2025-01-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11750235/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143013514","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}