B. Yespembetov, M. Sarmykova, A. Sambetbaev, E. B. Serikbay, N. Syrym, N. Zinina, A. M. Anarbekova, K. K. Tileukhanov
{"title":"STUDY OF THE EPIZOOTIC SITUATION OF HORSE WASHING IN THE ALMATY REGION","authors":"B. Yespembetov, M. Sarmykova, A. Sambetbaev, E. B. Serikbay, N. Syrym, N. Zinina, A. M. Anarbekova, K. K. Tileukhanov","doi":"10.58318/2957-5702-2022-12-44-55","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-12-44-55","url":null,"abstract":"This article presents the results of statistical data as of July 1, compared with the same date last year, the number of horses as a whole increased by 8.5%, amounting to 3372.5 thousand heads as of July 1. However, during the winter months (January and February), the number of horses in Kazakhstan decreased by 1.3%. In absolute terms, the number of horses in January decreased by 20.2 thousand heads, and in February by another 16.6 thousand heads. In recent years, the country has seen an increase in the incidence of mytomy not only among foals, but also among adult livestock. In order to conduct epizootological monitoring of washing of horses, according to the calendar plan of the project IRN 08855635, from 2020-2022 scientific expeditions were organized on the territory of the Almaty region of the republic with the sampling of pathological material from sick animals. As a result of the purposeful organization and conduct of expedition trips, the necessary epidemiological data were collected and the analysis of ongoing veterinary and sanitary measures was carried out. As a result of this stage, samples were collected in a total of 112 samples of biomaterial from sick washed foals during sowing, it was possible to isolate the culture of the microbe only in 3 cases. This circumstance is due to the fact that the modified forms of mytaceous streptococcus causing atypical cases of the disease are very difficult to cultivate. According to the results of the study, bacterial isolates were identified as the species Streptococcus equi.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"1 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"129158504","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"ANTHRAX AND THE RISKS OF THE DISEASE IN THE REPUBLIC OF KAZAKHSTAN","authors":"T. S. Chukayeva","doi":"10.58318/2957-5702-2022-11-23-31","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-11-23-31","url":null,"abstract":"this article presents the epizootic and epidemiological situation of anthrax in the Republic of Kazakhstan and abroad over the past three years (2020-2022). The possible risks of penetration and spread of this disease from outside the country are shown.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"142 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"127313724","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"ROLE OF CORONAVIRUS IN ACUTE RESPIRATORY VIRAL INFECTIONS","authors":"R. Nurgaziev, E. D. Krutskaya","doi":"10.58318/2957-5702-2022-11-46-50","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-11-46-50","url":null,"abstract":"this review article is devoted to a brief description of the role of coronavirus infection in the onset of acute respiratory viral infections (ARI). These are influenza viruses, coronaviruses, including SARS-CoV-2, parainfluenza viruses, adenoviruses, pneumoviruses, including respiratory syncytial virus and metapneumoviruses, enteroviruses, rhinoviruses, bocaviruses. Environmental changes, warming climate, increasing population density, high migration activity and other factors provoke the emergence and spread of new infections around the world. The emergence in December 2019 of diseases caused by a new coronavirus (“Coronavirus disease 2019”) has already gone down in history as an international emergency. It is known that the most common clinical manifestation of the new infection is pneumonia, as well as respiratory distress syndrome in a large proportion of patients","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"10 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"134262868","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
U. Z. Kuzhebayeva, I. Beishova, V. Ulyanov, Т. V. Ulyanova, Alexandr Kovalchuk, N. Ginayatov, А. Z. Sidarova
{"title":"SELECTION OF SPECIFIC PRIMERS FOR PCR IN BOVINE LEUKEMIA VIRUS","authors":"U. Z. Kuzhebayeva, I. Beishova, V. Ulyanov, Т. V. Ulyanova, Alexandr Kovalchuk, N. Ginayatov, А. Z. Sidarova","doi":"10.58318/2957-5702-2022-12-24-35","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-12-24-35","url":null,"abstract":"the polymerase chain reaction (PCR) method is widely used to solve various problems. PCR is widely used for the detection of bacterial and viral pathogens. Primers are a very important component of PCR, since the specificity of amplification depends primarily on them. They are necessary for the enzyme to work and are specific to the fragment of interest. Based on the results of the selection of nucleotide sequences of the genome or individual fragments of the virus RNA from the international database on the NCBI website, a large number of sequences for the bovine leukemia virus were identified, which are stored in gene banks and updated daily with new data. The construction of primers in compliance with the necessary parameters is carried out using various computer programs, the main of which are MUSCLE, UGENE V.36.0, Primer-BLAST, Oligo Analyzer and others. The designed primers were then synthesized on the Expedite 8909 oligonucleotide synthesizer, according to the instructions attached to the device. As a result of our experiments, we selected and synthesized specific synthetic oligonucleotides env (g51)_1 and env (g51)_2, for setting up PCR for bovine leukemia.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"10 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"128574234","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
B. Myrzakhmetova, K. B. Bisenbayeva, M. S. Kaukarbayeva, Y. Burashev, L. Kutumbetov
{"title":"CULTURAL PROPERTIES OF THE SOUTH AFRICAN VARIANT OF OMICRON VIRUS SARS-CoV-2 OF CORONAVIRUS INFECTION COVID-19","authors":"B. Myrzakhmetova, K. B. Bisenbayeva, M. S. Kaukarbayeva, Y. Burashev, L. Kutumbetov","doi":"10.58318/2957-5702-2022-12-36-43","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-12-36-43","url":null,"abstract":"this paper presents data on the study of the cultural properties of the genetic variant Omicron of the SARS-CoV-2 virus of the coronavirus infection COVID-19. The most permissive biological systems for the reproduction of this virus variant are Vero, MA-104, MARC-145, PK-15, and SPEV cell cultures. The productive conditions for cultivating the genetic variant Omicron of the SARS-CoV-2 virus in the studied cell lines turned out to be the following parameters: seeding concentration of cells 200 thousand/cm3, multiplicity of infection – 0.01 TCD50/cell, virus cultivation period – 2 days, cell lesion area monolayer before collecting the virus – 75-80%, the biological activity of the virus in the range from 4.14±0.31 to 6.66±0.22 lg TCD50/cm 3.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"84 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"126206044","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"SELECTION OF HIGHLY PRODUCTIVE GENOTYPES OF SUGAR SORGHUM (SORGHUM BICOLOR L) FOR FURTHER USE IN PHYTOREMEDIATION OF SOILS FROM HEAVY METALS","authors":"A. Sagimbayeva","doi":"10.58318/2957-5702-2022-11-32-38","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-11-32-38","url":null,"abstract":"at the moment, soil pollution is the main environmental problem, which leads to a great need for the restoration of contaminated soils using the most appropriate and effective cleaning methods. Conventional remediation and bioremediation of contaminated sites usually involves the physical removal of pollutants or biological exposure with the help of microorganisms. Basic physical recovery strategies are expensive, non-specific, and often render the soil unsuitable for further use by disrupting the microenvironment. Due to these concerns, there has been increased interest in environmentally friendly and sustainable approaches, such as phytostabilization, phytoremediation and phytofiltration for cleaning contaminated sites. In this article, special attention is paid to the selection of highly productive genotypes of sugar sorghum for further use in phytoremediation of soils from heavy metals. Removal of heavy metals from the environment with the help of plants in the modern world is a very effective and highly profitable method. In this regard, the identification and study of promising plants is the basis of successful biotechnology. From this point of view, sorghum crops are attractive. They have properties such as resistance to extreme drought, heat and salt resistance","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"14 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"128789742","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
N. Feoktistova, E. Suldina, A. Mastilenko, A. Lomakin
{"title":"APPROVAL OF THE TEST-SYSTEM FOR THE INDICATION AND IDENTIFICATION OF ASPERGILLUS FLAVUS BY THE METHOD OF POLYMERASE CHAIN REACTION IN THE “REAL TIME” MODE","authors":"N. Feoktistova, E. Suldina, A. Mastilenko, A. Lomakin","doi":"10.58318/2957-5702-2022-12-67-73","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-12-67-73","url":null,"abstract":"the article presents the results of studies on approbation of a test system for the indication and identification of microscopic fungi Aspergillus flavus by the polymerase chain reaction method with real-time detection. Using software Multiple Sequence Alignment Viewer 1.22.1 and UGENA 44.0. The test system for A. flavus includes specific primers: forward primer (f) 5’-3’ GGGCCCGCAGCAAGAATAC, reverse primer (r) 3’-5’ ACGAGTTGTCACCTTCCCGAGA; fluorescent dye: HEX, probe - CGGTTCGCTTTGGTCATCGT, quencher BHQ2. Reaction protocol: preliminary denaturation - 95 0C - 5 minutes (1 cycle); denaturation - 95 0C - 5 sec, annealing - 60 0C - 15 sec (50 cycles). Probe: AGCATAGGCTGATGCTCGTAGGC, fluorescent dye - ROX, quencher - BHQ-2. The sensitivity of the test system is 1000 cells. The optimal concentration of primers was set equal to 9 pM of each primer per reaction. The optimal probe concentration is 0.4 pM. The results obtained indicate that the use of dichotomous keys does not allow the most accurate differentiation of phytopathogenic fungi A. flavus. A new approach to the identification of isolates confirmed the belonging of 15 isolated strains to the species A. flavus out of 20 isolated from corn samples with signs that manifest themselves as root rot and wilting, and initially typed as Aspergillus based on the study of cultural and morphological properties. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"50 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"123363669","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"SUBTROPIC PERSIMMON FRUIT – A SOURCE OF ANTIOXIDANTS","authors":"Ye. Fokina","doi":"10.58318/2957-5702-2022-12-6-23","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-12-6-23","url":null,"abstract":"antioxidants are substances that inhibit oxidation and are able to neutralize the oxidative effect of free radicals. Dietary-derived antioxidants are now increasingly being researched for their positive health effects, including their role in the prevention of various diseases. In general, plant antioxidants receive a lot of attention as they can be consumed for longer periods of time without any side effects. Fruits are an important component of the human diet and play an important role in maintaining health. This is due to the presence of bioactive components that have a beneficial effect on human physiology. A number of plants have gained popularity as useful food items. Among them, persimmon (Diospyros kaki L.) can be distinguished, the fruits of which are nutritious and have strong antioxidant activity. This review summarizes data on the types of persimmon, its properties and methods of use.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"27 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"134367450","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Т. A. Toleukhan, Z. Kirkimbayeva, А. Z. Zhylkaidar
{"title":"BIOLOGICAL PROPERTIES OF CL. PERFRINGENS STRAINS","authors":"Т. A. Toleukhan, Z. Kirkimbayeva, А. Z. Zhylkaidar","doi":"10.58318/2957-5702-2022-11-39-45","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-11-39-45","url":null,"abstract":"the biological properties of isolated clostridium were studied, clostridium isolates were identified by cultural morphological properties.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"119 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"116892405","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"GEOGRAPHICAL DISTRIBUTION OF ANTHRAX FOCI IN THE CENTRAL-EASTERN REGIONS OF TAJIKISTAN","authors":"A. Muminov, Shuhrat N. Jumaev, M. Asrorzoda","doi":"10.58318/2957-5702-2022-11-6-12","DOIUrl":"https://doi.org/10.58318/2957-5702-2022-11-6-12","url":null,"abstract":"the article presents data on the study of the epizootic situation in the soil foci of anthrax in animals. The geography of the distribution of soil foci of the disease on the territory of this region has been revealed. The geography of the distribution of soil foci of the disease on the territory of this region has been revealed. It has been established that the epizootic situation for anthrax in the central - eastern region of Tajikistan remains unfavorable to date. It was revealed that the geography of the disease coverage (sign / cities) over the past 5 years in the Regions of Republican Subordination has increased and in 2016-2020 in 8 (61.5%) out of 13district and cities was noted of anthrax among animals. It was revealed that the probability of relapse of anthrax periodicity repeating diseases among farm animals and people associated with the presence of a large number of stationary unfavorable points in developed animal husbandry and on the transport routes of animals.","PeriodicalId":307725,"journal":{"name":"Biosafety and Biotechnology","volume":"46 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-01-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"128313454","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}