Plant disease最新文献

{"title":"Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.","authors":"William M Wintermantel, Tongyan Tian, Carol Chen, Nicholas Winarto, Shelly Szumski, Laura Jenkins Hladky, Suraj Gurung, John Palumbo","doi":"10.1094/PDIS-05-24-1009-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-05-24-1009-PDN","url":null,"abstract":"<p><p>Watermelon (<i>Citrullus lanatus</i>) and melon (<i>Cucumis melo</i>) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (<i>Bemisia tabaci</i>) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (<i>Opuntia auberi</i>) from Sonora, Mexico, and from one cactus (<i>O. cochenillifera</i>), lamb's ears (<i>Stachys byzantine</i>), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon a","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392444","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Colletotrichum siamense</i> Causing Leaf Anthracnose on Jackfruit in Thailand.","authors":"Surapong Khuna, Jaturong Kumla, Tanapol Thitla, Chanokned Senwanna, Nakarin Suwannarach","doi":"10.1094/PDIS-06-24-1273-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-06-24-1273-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Jackfruit (Artocarpus heterophyllus Lam.) is commonly grown in Thailand. In June 2023, leaf anthracnose on this plant was observed at a field in Chai Prakan District (19°42'24\"N, 99°01'59\"E), Chiang Mai Province, Thailand, with ~25% disease incidence in a 1000-m2 plantation area. The initial symptom had brown spots with a yellow halo, enlarged, elongated, 0.2 to 2 cm in diameter, irregular, sunken, brown, with a dark brown halo, and leaves withered and dried. Pale yellow conidiomata developed on the lesions in high humidity. Ten symptomatic leaves were used to isolate the fungal causal agents through a single spore isolation method (Tovar-Pedraza et al. 2020). Four fungal isolates (SDBR-CMU492 to SDBR-CMU495) with similar morphology were obtained. Colonies on potato dextrose agar (PDA) were 70 to 85 mm in diameter, white to grayish white with cottony mycelia, the reverse pale yellow after incubation at 25°C for 1 week. All isolates produced asexual structures. Setae were brown with 1 to 3 septa, 40 to 100 × 2.2 to 4.0 µm, a cylindrical base, and acuminate tip. Conidiophores were hyaline to pale brown, septate, and branched. Conidiogenous cells were hyaline to pale brown, cylindrical to ampulliform, 7.4 to 27.2 × 2.0 to 4.5 µm. Conidia were one celled, hyaline, smooth walled, cylindrical, ends rounded, guttulate, 11.1 to 15.7 × 3.4 to 6.1 µm. Appressoria were dark brown to black, oval to irregular, 8.8 to 24.9 × 3.6 to 10 µm. Morphologically, all isolates resembled the Colletotrichum gloeosporioides species complex (Weir et al. 2012). The internal transcribed spacer (ITS) region, actin (act), β-tubulin (tub2), calmodulin (CAL), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified using primer pairs ITS5/ITS4, ACT-512F/ACT-783R, T1/T22, CL1C/CL2C, and GDF1/GDR1, respectively (White et al. 1990; Weir et al. 2012). Sequences were deposited in GenBank (ITS: PP068858, PP068859, PP446789, PP446790; act: PP079636, PP079637, PP460760, PP460761; tub2: PP079638, PP079639, PP460762, PP460763; CAL: PP079634, PP079635, PP460758, PP460759; GAPDH: PP079632, PP079633, PP460756, PP460757). Maximum likelihood phylogenetic analyses of the concatenated five genes identified all isolates as C. siamense. To pathogenicity test, the mature leaves of a healthy plant were surface disinfested using 0.1% NaClO for 3 min, rinsed three times with sterile water, and wounded. Conidia suspensions (15 µl of 1 × 106 conidia/ml) of each isolate grown on PDA at 25°C for 2 weeks were used to inoculate wounded and unwounded samples by the attached method. Control leaves were mock inoculated with sterile distilled water. Ten replications were conducted for each treatment and repeated twice. Plants were placed in a greenhouse at 25 to 30°C and 80 to 90% relative humidity. After 7 days, all inoculated leaves displayed brown lesions, while control leaves had no symptoms. Colletotrichum siamense was reisolated from inoculated tissues on PDA to complete Koch's post","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392446","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Rhizopus arrhizusi</i> causing rot of <i>Dictyophora rubrovolvata</i> in China.","authors":"Shiqi Tu, Feng Zhou, Yin Zhang, YiFan Chen, ShengQian Chao, Beibei Lü, Hailong Yu","doi":"10.1094/PDIS-08-24-1767-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1767-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Dictyophora rubrovolvata, as an edible fungus with high medicinal value, is widely cultivated in several provinces in China (Hang et al. 2012). However, between December 2023 and March 2024, a rot disease occurred in the main production area in Fengxian District, Shanghai, China (N30°93', E121°49'). The disease incidence was 25% in the affected 1.33-ha growing area. High temperatures (&gt;25℃) and poor ventilation provide favorable conditions for the spread of this disease. The disease mainly occurs at the stage of fruiting bodies formation of D. rubrovolvata. When the epidermis is damaged and broken, it becomes infested with mold, which then produces a layer of moldy rot with pus. The infected D. rubrovolvata tissues at the edge of the lesions were isolated, surface sterilized and cultured on potato dextrose agar (PDA) at 30 ℃ under dark conditions. Pure cultures were obtained by single-spore isolation. After 3 days, isolates were transferred to Czapek Yeast agar (CYA) (Samson et al, 2014). On CYA, the fungal colony consisted of white flocculent hyphae. Scanning electron microscopy analysis showed that the mycelium was white, and the internodes of the stolons formed characteristic pseudoroots, from which upwardly clustered erect, unbranched sporocarp peduncles expanded apically to form rounded sporocarp sacs, within which sporocarp spores were produced. (Hariprasath P, 2019). To confirm the identity of the pathogen, the genomic fragments for the internal transcribed spacer (ITS) and intergenic spacer (IGS) gene of the isolate were amplified by PCR (White et al. 1990; Liu XY. 2008). The resulting sequence was deposited in GenBank with accession PP951880 and PQ001670, respectively. PCR results and morphological observations indicated the isolated strain was a pure culture and the strain was designated as DIC01. Comparative results showed that the sequences with accession numbers MT603964.1 and DQ990323.1 showed high homology of 99.15% and 98.96% to the ITS and IGS sequences of Rhizopus arrhizusi DIC01, respectively. Phylogenetic analysis with ITS and IGS genes of the isolated strain and 7 Rhizopus spp. strains were performed using MEGAX with Neighbor-Joining (NJ) method. Based on the results of growth habits, morphological observations, and phylogenetic analysis, the pathogen was identified as R. arrhizusi. A spore suspension of the R. arrhizusi DIC01 (1 x107 conidia/mL) was inoculated back to healthy D. rubrovolvata. Five healthy fruit bodies of D. rubrovolvata were injected, and another five healthy morels were treated with potato dextrose broth (PDB) as controls. D. rubrovolvata was incubated at 25°C and 90% relative humidity without ventilation for 5 days. The pathogen successfully infected the D. rubrovolvata, which developed white moldy lesions similar to those of natural diseases. The controls remained healthy without any symptoms. The pathogen was reisolated from the affected lesions and identified as R. arrhizusi DIC01 based on its mor","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392449","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of <i>Colletotrichum nymphaeae</i> causing anthracnose on Hass avocados in Brazil.","authors":"Vanessa Caroline de Oliveira, Hiago Antonio Oliveira da Silva, Fabrícia Queiroz Mendes, Eduardo Basílio de Oliveira, Lucas Magalhães de Abreu, Érica Nascif Rufino Vieira","doi":"10.1094/PDIS-08-24-1674-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1674-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;The Hass cultivar is one of the most cultivated and distributed avocado varieties throughout the world, having high productivity, nutritional quality, market acceptance and adaptation to different climatic zones (Dreher and Davenport 2013). Anthracnose affects avocado production in tropical and subtropical regions, causing economic losses, especially post-harvest (Fuentes-Aragón et al. 2020). Correct identification of Colletotrichum species causing anthracnose is essential, as different species vary in important phenotypes such as virulence and sensitivity to fungicides (Chen et al. 2016). Twelve samples from batches of avocados with anthracnose were collected in Minas Gerais State, Brazil, in September 2023. The observed symptoms were brown to black depressed circular spots, ranging from a few millimeters to 3 cm in diameter on the epicarp of the fruits, covered in center by mucilaginous layers of pathogen sporulation. Isolation was performed directly from the spore masses and monoconidial isolates were cultured in PDA at 25°C for 7 days for morphological characterization and preserved in sterile water at 4°C. One of the morphotypes commonly recovered from lesions, represented by isolate UCBV 362 (Culture Collection COAD 3843), formed fast-growing colonies having white aerial mycelium and intense salmon-colored sporulation. The cylindrical conidia were 13 to 17.5 μm long and 4.5 to 7 μm wide (average 14.5 x 5.7 μm, N=100), produced on conidiophores dispersed in the aerial mycelium or aggregated on melanized conidiomata formed on the agar. The partial sequence of the second largest subunit of the RNA polymerase II gene (RPB2) from isolate UCBV 362 (GenBank: PQ034617, 1116 nt) showed 99% of coverage and 99.37% of nucleotide identity with the RPB2 sequence of the ex-epitype strain of Colletotrichum nymphaeae ICMP 17918 (=CBS 515.78) (GenBank: JN985506). In a Maximum Likelihood phylogenetic tree composed with RBP2 sequences from reference strains of the Colletotrichum acutatum species complex, the isolate UCBV 362 formed a highly supported clade with the ex-epitype and other reference strains of Colletotrichum nymphaeae, occupying the Clade 2 of the species complex together with C. scovillae and C. simmondsii (Damm et al. 2012). This result shows the reliability of RPB2 for phylogeny and species delimitation within Colletotrichum. To confirm pathogenicity, 10-mm discs from a 7-day-old colony were inoculated at 3 different points on healthy-looking avocado fruits and incubated at 28°C. Uninoculated fruits served as controls. The first symptoms appeared 5 days after inoculation and were similar to those observed in the original samples, while the fruits in the control group remained asymptomatic. The pathogen was reisolated from the lesions and identified morphologically, fulfilling Koch's postulates. Colletotrichum nymphaeae has been associated with avocado anthracnose in Mexico (Fuentes-Aragón et al. 2020). In Brazil, a study based on molecula","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392445","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Ralstonia pseudosolanacearum</i> Causing Bacterial Wilt in Ginger in Peru.","authors":"José Soto-Heredia, Salome Ramos-Tito, Angelica Rodrigues Alves, Luciellen da Costa Ferreira, Luz Leonor Mattos Calderon, Maurício Rossato","doi":"10.1094/PDIS-09-24-1874-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-09-24-1874-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Around 90% of Peru's ginger (Zingiber officinale) production is concentrated in the Junín region, due to the optimal agroecological conditions for its cultivation. In March 2024, fields with ginger plants (cultivar Criollo) in Junín region, provinces Chanchamayo and Satipo, specifically in the cities of Pichanaqui and Satipo respectively, exhibited approximately 40% of plants with severe symptoms of a disease characterized initially by plant yellowing and rapid progressing to necrosis. Affected rhizomes showed dark vascular bundles with milky white exudates upon cutting, while stems displayed vascular necrosis hindering water and nutrient transport, often resulting in plant death. Fifteen plants were sampled and diseased vascular tissues from rhizomes and stems were cultured on nutrient agar (NA) and incubated at 28°C. After 72 h, all isolations resulted in colonies with typical characteristics of Ralstonia solanacearum species complex (RSSC) were produced, with appearing fluid, irregularly round, and creamy white. Three isolates were selected for the identification steps (UNALM-RP01 to 03) were identified by PCR using primers 759/760 (Opina et al. 1997) confirming as RSSC with a 282 bp amplification product. Additionally, isolates were assigned to biovar 3 based on their ability to metabolize three acid-producing disaccharides (maltose, lactose, cellobiose) and three hexose alcohols (mannitol, sorbitol, dulcitol) (Hayward, 1964). Phylotype I was identified by multiplex PCR (primers Nmult) with a 114 bp amplification product (Fegan and Prior 2005). For the identification of the sequevars of the three isolates, DNA was extracted and PCR with primers ENDO-F/R (Ji et al. 2007) were performed to amplify and sequence the partial gene sequence of egl gene with 681 bp in length. The phylogeny by Neighbor joining with 10,000 bootstraps clustered the UNALM isolates along other sequevar 30 of R. pseudosolanacearum. The sequences were deposited in Genbank under accessions PQ213016, PQ213017 and PQ213018. For pathogenicity tests, bacterial colonies of isolate UNALM-RP01 were scraped from the culture media with a sterile needle and introduced into the stems of three 2-month-old ginger plants (cultivar Gigante). The plants subsequently exhibited yellowing seven days post-inoculation. Additionally, the rhizomes showed internal discoloration and bacterial exudation. Three plants were used as a control, which were pierced with a sterilized needle and showed no symptoms. All tested plants were kept in a greenhouse with controlled temperature (20-40 °C) The pathogen was successfully re-isolated from infected plants on NA medium, presenting typical colonies of RSSC and identified via PCR with primers 759/760, fulfilling Koch's postulates. This represents the first case in Peru of ginger plants infected with a Ralstonia species, specifically R. solanacearum phylotype I, corresponding to R. pseudosolanacearum. This species of RSSC and sequevar is known for causi","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392448","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of Paprika mild mottle virus Infecting pepper (<i>Capsicum annuum</i> L.) in China.","authors":"Zhilei Han, Mingrui Gao, Zhiyong Yan, Hao Hong, Xiao Yin, Shuai Xu, Jiejun Peng, Fei Yan, Xiangdong Li, Shanshan Jiang","doi":"10.1094/PDIS-01-24-0191-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-01-24-0191-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Paprika mild mottle virus (PaMMV), a tobamovirus from the Virgaviridae family, has been reported to infect pepper (&lt;i&gt;Capsicum annuum&lt;/i&gt; L.) in the Netherlands (García-Luque et al., 1993), Japan (Hamada et al., 2003), Bulgaria (Ruíz del Pino et al., 2003), and Israel (Luria et al., 2018). Pepper has become the most widely planted vegetable and the most heavily consumed spicy condiment, with a large planting area (&gt;21,000 km&lt;sup&gt;2&lt;/sup&gt;) in China (Zou et al., 2021). However, the crop's productivity is limited by viral diseases. In August 2021, a survey of viral diseases was conducted across five pepper-growing regions in Linyi, Shandong Province, China, revealed that 5% to 10% of plants in most fields exhibited symptoms such as stunting, leaf narrowing, chlorosis, and crinkling of leaf tissue (Fig. S1-a). Subsequently, seven symptomatic samples (Fig. S1-b) were collected from a plot (118° 29' E, 34° 65' N) where thin-skinned peppers were grown. All samples tested positive in a Western blot assay using a polyclonal antibody for tobacco mosaic virus (TMV), indicating the presence of a tobamovirus (Fig. S1-c). To identify the virus, total RNAs were extracted from 10 different symptomatic pepper plant samples, using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) and combined into a single sample in equal amounts (100 ng/μL each). RNA-Seq was performed on this mixture using the Illumina NovaSeq 6000 (Illumina, San Diego, USA). Raw reads (6.92G) in fastq format were processed with in-house perl scripts to yield clean reads (6.68G), which were assembled into 780 contigs (mean length: 2036 bp) using Trinity software (v2.6.6). These contigs were then analysed using the NCBI BLASTX program (http://www.ncbi.nlm.nih.gov/blast) against the viral RefSeq database. The results demonstrated that the contigs exhibited an average genome coverage of 40.16%. Notably, one unique contig (6453 bp) was mapped to the PaMMV genome (reference sequence KX187305.1) with 98.34% identity. To verify the RNA-Seq result, a PaMMV-specific primer pair (forward: 5'-GAGTTCATAGAGGCAGTACC-3'; reverse: 5'-CTTCGATTTAAGTGGAGGGAT-3') was designed for amplifying an 800-nt fragment of the PaMMV coat protein (&lt;i&gt;CP&lt;/i&gt;) gene by RT-PCR. The 800-nt fragment was successfully amplified from all the symptomatic samples (Fig. S1-d). Sequenced RT-PCR products (GenBank No. OR365081.1) showed 99.75% nucleotide identity with PaMMV isolates (OQ198318.1, China, goat) according to BLAST analysis. Mechanical transmission of PaMMV from three infected pepper plants collected in Linyi to healthy pepper plants confirmed pathogenicity. Three pepper cultivars (trade name: Qiemen, Tianyu, Haonong11) were tested and showed varying symptoms post-inoculation (Fig. S1-e). All cultivars were confirmed in the lab to be PMMoV-sensitive and exhibited significant viral disease symptoms after PMMoV inoculation (data not shown). Each variety was inoculated with at least 3 seedlings from different field-collected v","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392451","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Exserohilum pedicellatum</i> Causing Root Rot of Wheat (<i>Triticum aestivum</i> L.) in Uzbekistan.","authors":"Anvar Gulmirzaevich Sherimbetov, Bakhtiyor Shukhratovich Adilov, Dilshod Rustam Ogli Ruzmetov","doi":"10.1094/PDIS-08-24-1788-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1788-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber wit","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392447","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of Bacterial Leaf Spot Disease on Ginger Caused by <i>Enterobacter quasiroggenkampii</i> in China.","authors":"Bo Tao, Xiaoli Li, Shengmao Zhou, Gaoqing Yuan","doi":"10.1094/PDIS-06-24-1254-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-06-24-1254-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;In autumn 2023, an unknown leaf spot disease has occurred on ginger (Zingiber officinale Roscoe) in two fields of approximately 1800 m2 in Yongning District (22°49'N; 108°48'E), Nanning, China, with a incidence of 20-30%. The symptoms began as yellow spots on the leaves, expanding into elliptical to irregular lesions with yellow edges, the middle of the lesion turning grey-white in dry weather. Finally, multiple spots caused necrosis of the whole leaf. Twelve diseased leaves from six plants of two fields were collected, surface disinfected and ground. The ground samples were diluted and plated on nutrient agar (NA) medium at 28 °C for 48-72 h. The purified colonies appeared milky white and round, with smooth edges. Three isolates (GL1, GL2 and GL3) were selected for identification and pathogenic determination. They were gram negative, could utilize sorbitol, mannitol, inositol, raffinose, melibiose, disaccharides, and citrate; negative for methyl red, phenylalanine decarboxylase, hydrogen sulfide, urease; positive for voges-proskauer test and ornithine decarboxylase. These characteristics were consistent with Enterobacter genus (Wu et al., 2020). Genomic DNA was extracted from three isolates. The 16S rDNA region was amplified using 27F/1492R primers (Weisburg et al. 1991) and sequenced (accession no. PP837703-PP837705). Blastn analysis revealed that 16S rDNA sequences for GL1 was 99% identical (1373/1387 nt), GL2 96% (1364/1422 nt) and GL3 95% (1365/1435 nt) to Enterobacter quasiroggenkampii WCHECL1060 (NR_179166). To determine the species, the sequences of gyrB, rpoB and atpD genes were amplified using primers gyrB 01-F/gyrB 02-R, rpoB CM7/rpoB CM31b, and atpD 01-F/atpD 02-R, respectively (Lin et al. 2015; Zhu at al. 2010; Zhang et al. 2013). The GenBank accession numbers for the sequences were PP857680-PP857688. A multilocus phylogenetic tree was constructed with the concatenated sequence of 16S rDNA-gyrB-rpoB-atpD by using the Neighbor-Joining (NJ) method with 1000 bootstrap replicates in MEGA6 software. The three isolates clustered with E. quasiroggenkampii. Fifteen Darou ginger variety plants at the 4-5 leaf stage were tested for pathogenicity. Two to three leaves of each ginger plant were pricked with a syringe needle of 0.36mm in diameter or not and inoculated by spraying the bacterial suspension (108 CFU/mL), sterile water was used as a control. Five plants were inoculated with each isolate and the test was repeated three times. After 3-4 days of inoculation, all wounded leaves and about 10% of the unwounded leaves showed symptoms similar to those observed in the field. Control plants did not develop symptoms. Enterobacter quasiroggenkampii isolates were re-isolated from the inoculated leaves with symptoms, and their identity was confirmed by gyrB sequencing and colony morphology, completing Koch's postulates. Enterobacter quasiroggenkampii is a pathogen of humans that can cause nosocomial infections (Wu et al., 2020). In Guangxi, E","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392450","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"The Efficacy of Orange Terpene and <i>Bacillus mycoides</i> Strain BM103 on the Control of Periwinkle Leaf Yellowing Phytoplasma.","authors":"Jui-Chen Hung, Tzu-Pi Huang, Jenn-Wen Huang, Chung Jan Chang, Fuh-Jyh Jan","doi":"10.1094/PDIS-07-24-1547-RE","DOIUrl":"https://doi.org/10.1094/PDIS-07-24-1547-RE","url":null,"abstract":"<p><p>Phytoplasmas are obligate phytopathogenic bacteria belonging to the class Mollicutes. The pathogens, transmitted by insect vectors, associated with hundreds of plant diseases worldwide. Due to the regulation on banning use of antibiotics and limited efficacy of the traditional disease management manners, an eco-friendly alternative is needed. Given that terpene and probiotics have antibiotic activity and the ability to induce systemic resistance, in this study, the effectiveness of orange terpene and a Bacillus mycoides strain, BM103, was evaluated in periwinkle plants infected with periwinkle leaf yellowing (PLY) phytoplasma derived from a shoot-tip tissue culture system. Weekly drenching of 1,000 ppm diluted orange terpene emulsion or pre-activated strain BM103 liquid culture dilution exhibited the ability to inhibit PLY phytoplasma accumulation. The expression of the genes associated with plant defense response and flower development was upregulated after treatment. Moreover, pre-treatment of orange terpene or strain BM103 delayed PLY infection via cleft-grafting inoculation. While orange terpene did not suppress the symptoms, strain BM103 did result in a milder symptom expression that might partially attribute to its plant growth-promoting characteristics. Additionally, the pre-activation of strain BM103 may contribute to its efficacy. Taken together, this research indicates that orange terpene and B. mycoides BM103, with the ability to rapidly induce plant defense responses, could potentially be developed into biological control materials as preventive agents or biofertilizers.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392452","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Pyrrolnitrin in <i>Pseudomonas chlororaphis</i> strain AFS009 metabolites reduces constitutive and DMI-induced MfCYP51 gene expression in <i>Monilinia fructicola</i>.","authors":"Johanna Wesche, Peishan Wu, Chaoxi Luo, Guido Schnabel","doi":"10.1094/PDIS-07-24-1470-RE","DOIUrl":"https://doi.org/10.1094/PDIS-07-24-1470-RE","url":null,"abstract":"<p><p>Brown rot, caused by Monilinia fructicola, is one of the most economically important diseases of peach. Demethylation inhibitor (DMI) fungicides play an important part in managing brown rot in the southeastern U.S., but over the last 20 years, reduced efficacy to DMIs has been reported in field isolates overexpressing the DMI target enzyme encoding MfCYP51 gene. Metabolites of the biocontrol agent (BCA) Pseudomonas chlororaphis strain AFS009 suppressed the MfCYP51 gene in sensitive and resistant M. fructicola isolates previousely, but it is not known what molecule was responsible. The goals of this study were to determine the presence and role of pyrrolnitrin (PRN), a common metabolite of P. chlororaphis and chemical analogue to fludioxonil with antifungal activity, in the suppression of the MfCYP51 gene and to investigate if MfCYP51 expression can also be suppressed by Bacillus subtilis. High-performance liquid chromatography (HPLC) detected pyrrolnitrin at 1.75 µg/mg in P. chlororaphis metabolites formulated as Howler EVO (Howler). PRN at 0.1 µg/ml, fludioxonil at 0.1 µg/ml, and Howler applied at a dose that contained 0.1 µg/ml PRN significantly reduced the MfCYP51 gene expression at similar levels in DMI-resistant isolates. Furthermore, MfCYP51 expression in DMI-sensitive and three DMI-resistant isolates treated with Howler (88.1 µg/ml), Theia (209.5 µg/ml), propiconazole (0.3 µg/ml), or the mixture of either Howler or Theia + propiconazole revealed that Howler significantly reduced the MfCYP51 target gene expression in two of three sensitive and all three resistant M. fructicola isolates. On the other hand, Theia showed no suppressive effect and even increased the MfCYP51 gene expression level in two of three resistant isolates. In detached fruit assays on apple with a DMI resistant isolate, only the mixture of Howler + 50 µg/ml propiconazole resulted in synergism. The results indicate that suppression of MfCYP51 target gene is BCA-dependent and can be induced by pyrrolnitrin.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-10-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142366221","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}