Plant disease最新文献

{"title":"First report of <i>Sclerotinia minor</i> causing soft rot of <i>Scabiosa atropurpurea</i> in California.","authors":"Jesica Calderon, Sophia Acker, Karina Elfar, Chris Greer, Johanna Del Castillo Múnera","doi":"10.1094/PDIS-08-24-1631-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1631-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;In May of 2019, Scabiosa atropurpurea samples with brown discoloration, soft rot of the crown and lower stem, with presence of white mycelium and black sclerotia (Supp. Fig. 1A, B) were collected from a 0.10 ha open field diversified cut flower production in San Luis Obispo County, CA. Approximately 30 to 40% of the scabiosa crop planted in a quarter of the field, exhibited symptoms. Symptomatic crowns and lower stems from five plants were surface disinfested by rinsing in 0.1% Tween 20, soaking in 70% ethanol for 30 s, 1% sodium hypochlorite for 2 min and sterile water. Disinfested tissue was placed in 1/10 potato dextrose agar (PDA) and incubated at 20°C (12 h photoperiod). Resulting colonies (n = 5) formed abundant white mycelia, with black sclerotia formed on the outer edge of the plates after two weeks (Suppl. Fig. 1C). Sclerotia (n = 50) had an average size of 1.6 (± 0.19) mm in diameter. Morphological identification resulted in Sclerotinia sp. (Hao et al., 2003). The pathogen was further identified by DNA extraction of two hyphal tipped isolates, followed by amplification and sequencing of the rDNA internal transcribed spacer (ITS) region, ITS1/ITS4 (White et al. 1990), calmodulin (CaM), CAL-228F/CAL-737R (Carbone and Kohn, 1999), and DNA replication licensing factor Mcm7 Mcm7-709for/Mcm7-1348rev (Schmitt et al., 2009). NCBI BLAST searches with consensus sequences for each maker revealed 99 to 100% identity with S. minor ex-types for all loci (Supp. Table 1). A maximum parsimony multilocus phylogenetic analysis clustered Californian isolates with reference strains of S. minor (Supp. Fig. 1F). Sequences were deposited in GenBank (Supp. Table 1). Pathogenicity tests were conducted with isolate CS435, which was transferred onto PDA plates and incubated at 20°C for one week. Inoculum consisted of CS435 infested PDA plugs (1 cm3). In the greenhouse, the experiment was set as a complete randomized design and observed for six weeks. Fourteen-week-old scabiosa 'Merlot Red' grown in 3.78 L pots (n = 6), were inoculated by wounding plants at 0.5 cm above the crowns with a 1 mm probe. Inoculum was placed directly on top of the wound and was secured with parafilm. Negative control plants (n = 6) were wounded as above and inoculated with PDA plugs. In experiment 1(19.4 (± 3) °C, RH 46.9), 83% of plants exhibited yellowing of the lower leaves and wilting at one week post inoculation (wpi). Symptoms progressed over time until wilting, major leaf and stem necrosis, was observed in all inoculated plants (Supp. Fig 1E, D). Plant mortality incidence at five wpi was 83%. Pathogen signs including white mycelia and black sclerotia were also observed. In experiment 2 (20.0 (± 10) °C, RH 39.6), 66% of the total plants were symptomatic at five wpi: 33% exhibited yellowing of the lower leaves and wilting, and 33% of plants died. Disease did not develop in non-inoculated plants in either experiment. S. minor was successfully reisolated from surface disinfested","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142406703","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of <i>Trichoderma roseum</i> causing tea leaf rot in China.","authors":"Jinmei Lei, Bingbing Jiang, Fang Yang, Cunwu Guo, Xiao Fang He, Li Mei Li, Shihao Zhang, Ya Min Wu, Chun Yan Liu, Li Jiao Chen, Bai Juan Wang","doi":"10.1094/PDIS-07-24-1419-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-07-24-1419-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Tea (Camellia sinensis) is consumed worldwide for its numerous benefits and China lead the world production. In March 2023, leaf spots were observed on approximately 10% of tea plants in a 50-ha commercial tea plantation in Menghai (21°46'13\"N, 100°30'6\"E), Yunnan, China. Initial symptoms appeared as small spots, which progressively expanded and spread over the entire leaf surface. Subsequently, pale pink mold layers developed from the lesions (Fig. S1). To isolate the pathogen, small leaf pieces (3 × 3 mm) were cut from the margins of the lesions, sterilized with 75% ethanol for 30 sec and 0.5% NaClO for another 30 sec, and rinsed three times with sterile water. The pieces were placed on acidified potato dextrose agar (PDA) plates and incubated in darkness at 28°C. A total of 15 fungal isolates with identical morphologies were collected. The colonies appeared pale pink with white mycelia initially then turned orange-pink at the center and light white at the edges. After 10-15 days, exhibiting a powdery texture and concentric rings with uniform edges. Conidia were found at the apex peduncle and were inverted pear-shaped or oval, either non-septate (15.3 ± 2 × 7.8 ± 1.8 μm in size, n = 60) or septate, with a slightly constricted spore base featuring papillary projecvtions (14.8 ± 1.5 × 7.4 ± 0.7 μm in size, n = 60). The morphology closely resembled Trichoderma roseum (Oh et al. 2014). To confirm the species, the strain CYB5 was selected for identification by sequencing the ribosomal internal transcribed spacer (ITS) and large subunit (LSU) genes using polymerase chain reaction (PCR) (White et al.1990). The ITS (GenBank accession OR889657) and LSU (PQ270526) gene sequences exhibited 98% similarity with the Trichoderma roseum sequence KP317992 from NCBI database. A phylogenetic tree was constructed using MEGA 11 (Felsenstein 1981) based on the concatenated sequences (ITS and LSU) of the strain CYB5 and reference strains (Fig. S2). The analysis confirmed that CYB5 is T. roseum (Inácio et al. 2011). Pathogenicity tests were conducted on detached healthy tea leaves placed on wet filter paper in petri dishes. Micro-wounds were made on leaves using a sterilized needle, followed by inoculation with a 6-mm plug of CYB5. Control leaves were inoculates with fungus-free agar disks. The dishes were incubated at 25°C in the dark for 7 days. The leaves inoculated with CYB5 developed reddish brown to dark brown lesions around the inoculated sites, while control leaves remained asymptomatic. The fungus was reisolated from the lesion, and the isolates were morphologically identical to the original cultures. A second pathogenicity test was conducted on potted tea plants of the cultivar 'Yunkang No. 10.' Three plants scratched with a needle and three non-wounded plants were inoculated by spraying 20 ml of a spore suspension (105 spores/ml) of CYB5. Plants sprayed with sterile water served as controls. All plants were maintained in a growth chamber at 28°C, and ","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142406704","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of basal stem rot on sugarcane (var. Badila) caused by <i>Sclerotium rolfsii</i> in China.","authors":"Su-Chan Lao, Su-Juan Lao, Ji-Hua Huang, Zhu-Gui Zhou, Shan-Hai Lin","doi":"10.1094/PDIS-07-24-1460-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-07-24-1460-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Badila (Saccharum officinarum) is one of the important chewing cane in south China. During the year 2019-2020, as much as 60.2%-87.5% of sugarcane plants stem showed red rot developments were observed in the fields of Yongning District, Nanning city, Guangxi province. Symptomatic plants showed red rot at basal stem nodes and sheath, when the disease serious, the epidermis and aerial roots decomposed and exfoliated, then formed sclerotiums, the upper stem also occurred the symptom. Infected plant tissues were dissected into small pieces with 0.1 × 0.1cm in size and surface sterilized in 0.1% HCl2 for 2 min, followed by 75% ethanol for 30 s, rinsed three times with sterile distilled water. Then the tissues were placed onto potato dextrose agar (PDA) plates and incubated at 25 °C for 3 days. Numerous white globoid sclerotia were formed on PDA after 5 days of growth. The sclerotia (2 to 3 mm in diameter) were white at first and then gradually turned dark brown. Aerial mycelia usually formed many narrow hyphal strands 4 to 9 μm wide. Five uniform isolates were obtained from diseased sugarcane plants. Pathogenicity of representative strain W1 was confirmed by inoculating 120-day-old Badila plants grown in field. Five plants were inoculated with colonized agar discs (6mm in diameter) by applying toothpick tips to the lower part of the stem. Five non-inoculated plants served as control. The inoculated and non-inoculated plants were sprayed sterile water then incubated with plastic film for maintained high moisture. All the plants were placed inside of a growth chamber at 26 ± 2°C with a 14-h photoperiod and 80% relative humidity. All inoculated plants showed red rot at stem and sheath after 2 weeks, whereas the control plants were symptomless. By the third week, mycelium and sclerotia developed on the crown on the inoculated plants. The fungus was re-isolated from the artificially inoculated plants. To confirm the species-level identification, partial of the ribosomal DNA internal transcribed spacer (ITS), mitocondrial small subunit (SSU), and nuclear ribosomal large subunit (LSU) regions of representative strain W1 were amplified and sequenced using the primers pairs ITS1/ITS4 (White et al. 1990), ITS-Fu-F /ITS-Fu-R and SRLSU1//SRLSU2 (Kumar et al., 2016), respectively. The resulting ITS, SSU and LSU sequences were deposited in GenBank (GenBank accession no. MW620994, MW617878, and MW617872) and shared 99.42%, 100% and 100% sequence identity with Athelia rolfsii isolate (JN017199, OM319631, and MT225781). Phylogenetic analysis conducted with neighbor-joining (NJ) method using MEGA6.0 revealed that the isolate share a common clade with reference sequence of A. rolfsii in GenBank Data Library. Based on morphological and molecular characteristics, the fungus was identified as A. rolfsii (anamorph: Sclerotium rolfsii) (Paul et al. 2017; Paparu et al. 2020). Although S. rolfsii has been reported causing sugarcane sett rot in Australia (Bhuiyan et al., ","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142406705","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Pre-Plant Soil Treatments Influence Tree Performance and Nematode Dynamics in Replanted Cherry Orchards.","authors":"Ali Yaghoubi, Razieh Yazdani, Emilie Cole, Marisol Quintanilla","doi":"10.1094/PDIS-06-24-1178-RE","DOIUrl":"https://doi.org/10.1094/PDIS-06-24-1178-RE","url":null,"abstract":"<p><p>In this two-year field study, the impacts of pre-plant soil management strategies, including soil fumigation, nematicide application, and organic amendments, on the growth and nematode community dynamics on cherry cultivars 'Emperor Francis' and 'Ulster' grafted to 'Mahaleb' rootstock were investigated in a replanted orchard site. In the first year, fumigation with 1,3-dichloropropene - chloropicrin mixture (Telone C-35) led to significantly increased trunk cross-sectional area and canopy height in both cultivars. Pratylenchus penetrans population densities were suppressed only short-term. Plots treated with the fungicide/nematicide fluopyram (Velum® Prime) had P. penetrans reproduction factors below one throughout both years independent of the scion. Additionally, the combined application of Seed Starter 101®, Dairy Doo® compost, and straw mulch reduced the reproduction factor of P. penetrans to below one in the first year. In the same time period, this combinatory treatment had the highest reproduction factor for bacterivore and fungivore nematodes. Based on results of this study, fumigation with Telone® C-35 resulted in improvement of tree establishment and provided effective short-term suppression of P. penetrans. Velum® Prime exhibited longer-term efficacy for the suppression of P. penetrans.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142406707","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Susceptibility of olive cultivars and selections to <i>Colletotrichum</i> species causing anthracnose in Spain.","authors":"Anabel Exposito-Diaz, Boris X Camiletti, M Teresa Garcia-Lopez, Diego Cabello, Dov Prusky, Concepción M Diez, Juan Moral","doi":"10.1094/PDIS-02-24-0481-RE","DOIUrl":"https://doi.org/10.1094/PDIS-02-24-0481-RE","url":null,"abstract":"<p><p>Anthracnose, the most critical fruit disease affecting olive crops, necessitates the evaluation of the susceptibility of traditional and new varieties. In Spain and Portugal, Anthracnose is caused by several Colletotrichum species, with C. godetiae and C. nymphaeae being dominant and C. acutatum and C. fioriniae being secondary. This study explores the susceptibility of fruits from an F1 progeny resulting from a cross between 'Picual' (resistant) and 'Arbequina' (moderately susceptible) cultivars to C. godetiae. While most genotypes showed resistance levels comparable to their parents, seven showed a 50% reduction in disease severity compared to 'Picual.' The normal distribution of genotypes' response to the pathogen suggests a complex resistance mechanism. Furthermore, we assessed the susceptibility of four traditional cultivars, two new cultivars ('Sikitita-2' and 'Martina'), and five advanced selections (pre-commercial genotypes) to C. godetiae and C. nymphaeae. Despite the significant interaction between the olive genotype and Colletotrichum species in this experiment, the new cultivars and advanced selections were classified as susceptible or moderately susceptible against both species. A subsequent analysis of the interaction between 'Picual' (resistant) and 'Hojiblanca' (susceptible) fruits with the four mentioned Colletotrichum species revealed significant differences among cultivars but no interaction between genotype and pathogen species. Colletotrichum species were categorized as follows: i) C. godetiae and C. nymphaeae as highly virulent, ii) C. acutatum as moderately virulent, and iii) C. fioriniae as weakly virulent. Finally, C. nymphaeae exhibited an enhanced ability to infect and develop acervuli in olive leaves, potentially serving as an inoculum source for this species. The absence of a correlation between leaf and fruit susceptibilities to the pathogen suggests differences in resistance mechanisms. In conclusion, this study provides valuable insights into the complex interactions between olive genotype and Colletotrichum species, essential for cultivar selection and understanding the disease cycle.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142406708","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Anthracnose Caused by <i>Colletotrichum spaethianum</i> on <i>Polygonatum odoratum</i> var. <i>pluriflorum</i> in Korea.","authors":"Joon-Ho Choi, Hyeon-Dong Shin, Young-Joon Choi","doi":"10.1094/PDIS-05-24-0991-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-05-24-0991-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Polygonatum odoratum var. pluriflorum (Miq.) Ohwi (Asparagaceae), commonly known as Lesser Solomon's seal, is a perennial herbaceous plant widely distributed in the temperate regions of the Northern Hemisphere. It is known for tea and contains various pharmacologically active compounds (Chang et al. 2007). In September 2021, previously unseen anthracnose was encountered on Polygonatum odoratum var. pluriflorum in Chuncheon (37°45'07''N; 127°47'45''E) and Wanju (35°38'47''N; 127°31'16''E), Korea, with a disease incidence of 20 to 30% of the inspected plants. The disease symptoms begin with leaf yellowing (chlorosis) along the margins, progressing toward the central part of the leaf. As the disease progressed, brown necrotic lesions developed, covered with small, dark dots, indicating the presence of conidiomata of Colletotrichum. The disease often led to leaf blight, resulting in concentric lesions of a periodic and concentric arrangement of conidiomata, forming circular patterns within the affected tissue. It expanded rapidly during the rainy season producing water-soaked lesions but nearly slowed down during the dry season, leaving the plant with a ragged appearance. Monoconidial isolates were obtained from five fresh samples collected in Wanju, of which a representative isolate was deposited in the Korean Agricultural Culture Collection (KACC410442), and the dried specimen was housed at the herbarium of Jeonbuk National University (JBNU0135). Morphological characteristics of the fungus were examined with fresh and naturally infected leaves. Setae (n = 30) were dark brown to nearly blackish, 45 to 172 um long, 4.1 to 6.1 µm wide at the base, and becoming narrower upwards, apex pointed, 2 to 4-septate. Conidia were 1-celled, sometimes uniseptate before germination, slightly curved, with an acute or rounded apex and a more or less truncate base, and 11.4 to 23.2 × 3.1 to 4.2 µm. Appressoria were single or in groups, dark brown, lobate, irregularly shaped, and 6.0 to 11.9 × 7.0 to 14.8 µm. Two-week-old colonies grown on PDA at 25 ℃ reached 30-35 mm in diam., initially white, turning gray with age, with cottony aerial mycelia. These morphological characteristics were in good agreement with those of C. spaethianum (Damm et al. 2009; Liu et al. 2020). To confirm the morphology-based determination, genomic DNA was extracted from KACC410442, and multi-loci sequences of the internal transcribed spacer region (ITS) rDNA, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), actin (actA), chitin synthase (CHS1), histone (HIS3) and tubulin (TUB2) genes were determined, as outlined by Cannon et al. (2012) and Damm et al. (2009). The resulting sequences obtained in this study were registered to GenBank (PP739190 for ITS, PP741985 for GAPDH, PP741986 for actA, PP741987 for CHS1, PP741988 for HIS3, and PP741989 for TUB2) and compared with other sequences on GenBank using the BLASTn search tool. The results showed 100% identity to other C. spaethianum sequence","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142406701","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Confirmation of oat crown rust disease in Taiwan.","authors":"Chung-Yin Ho, Eva Henningsen, Ssu-Tung Chen, Hiran Anjana Ariyawansa, Eric S Nazareno, Jana Sperschneider, Peter Dodds, Jakob M Riddle, Shahryar F Kianian, Melania Figueroa, Yung-Fen Huang","doi":"10.1094/PDIS-04-24-0838-RE","DOIUrl":"https://doi.org/10.1094/PDIS-04-24-0838-RE","url":null,"abstract":"<p><p>Oat is a minor forage crop grown in Taiwan. Only a few historical records of oat rust disease have been reported in the country. Therefore, the pathogen population remains poorly characterized. A rust-like disease outbreak was detected at the Experimental Farm of National Taiwan University in 2019, which caused significant damage to field experiments. To determine the identity of the pathogen responsible for this disease outbreak, we collected infected foliar material. Disease signs suggested infection by the oat crown rust fungus. Hence, common procedures in rust pathology were applied to confirm the identity of the pathogen with phenotypic and molecular diagnostic techniques. A total of 50 field pathogen samples from infected oat cultivars were collected in 2019 and five single pustule rust isolates were obtained in 2020 and 2021. These isolates were initially identified as <i>Puccinia coronata</i> var. <i>avenae</i> f. sp. <i>avenae</i> (<i>Pca</i>) based on the phylogenetic analysis of nrITS sequence data. This identification was subsequently confirmed through whole-genome phylogeny, which showed that the representative Taiwanese isolate NTU1 clustered with other <i>Pca</i> representative strains in Basidiomycota. Phenotyping assays across 36 oat differential lines demonstrated that Taiwanese isolates are phenotypically similar with relatively low virulence. This study presents the first molecular confirmation of <i>Pca</i> in Taiwan and reports the virulence profiles of Taiwanese <i>Pca</i> population.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142406702","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.","authors":"William M Wintermantel, Tongyan Tian, Carol Chen, Nicholas Winarto, Shelly Szumski, Laura Jenkins Hladky, Suraj Gurung, John Palumbo","doi":"10.1094/PDIS-05-24-1009-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-05-24-1009-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Watermelon (&lt;i&gt;Citrullus lanatus&lt;/i&gt;) and melon (&lt;i&gt;Cucumis melo&lt;/i&gt;) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (&lt;i&gt;Bemisia tabaci&lt;/i&gt;) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (&lt;i&gt;Opuntia auberi&lt;/i&gt;) from Sonora, Mexico, and from one cactus (&lt;i&gt;O. cochenillifera&lt;/i&gt;), lamb's ears (&lt;i&gt;Stachys byzantine&lt;/i&gt;), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon a","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392444","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Colletotrichum siamense</i> Causing Leaf Anthracnose on Jackfruit in Thailand.","authors":"Surapong Khuna, Jaturong Kumla, Tanapol Thitla, Chanokned Senwanna, Nakarin Suwannarach","doi":"10.1094/PDIS-06-24-1273-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-06-24-1273-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Jackfruit (Artocarpus heterophyllus Lam.) is commonly grown in Thailand. In June 2023, leaf anthracnose on this plant was observed at a field in Chai Prakan District (19°42'24\"N, 99°01'59\"E), Chiang Mai Province, Thailand, with ~25% disease incidence in a 1000-m2 plantation area. The initial symptom had brown spots with a yellow halo, enlarged, elongated, 0.2 to 2 cm in diameter, irregular, sunken, brown, with a dark brown halo, and leaves withered and dried. Pale yellow conidiomata developed on the lesions in high humidity. Ten symptomatic leaves were used to isolate the fungal causal agents through a single spore isolation method (Tovar-Pedraza et al. 2020). Four fungal isolates (SDBR-CMU492 to SDBR-CMU495) with similar morphology were obtained. Colonies on potato dextrose agar (PDA) were 70 to 85 mm in diameter, white to grayish white with cottony mycelia, the reverse pale yellow after incubation at 25°C for 1 week. All isolates produced asexual structures. Setae were brown with 1 to 3 septa, 40 to 100 × 2.2 to 4.0 µm, a cylindrical base, and acuminate tip. Conidiophores were hyaline to pale brown, septate, and branched. Conidiogenous cells were hyaline to pale brown, cylindrical to ampulliform, 7.4 to 27.2 × 2.0 to 4.5 µm. Conidia were one celled, hyaline, smooth walled, cylindrical, ends rounded, guttulate, 11.1 to 15.7 × 3.4 to 6.1 µm. Appressoria were dark brown to black, oval to irregular, 8.8 to 24.9 × 3.6 to 10 µm. Morphologically, all isolates resembled the Colletotrichum gloeosporioides species complex (Weir et al. 2012). The internal transcribed spacer (ITS) region, actin (act), β-tubulin (tub2), calmodulin (CAL), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified using primer pairs ITS5/ITS4, ACT-512F/ACT-783R, T1/T22, CL1C/CL2C, and GDF1/GDR1, respectively (White et al. 1990; Weir et al. 2012). Sequences were deposited in GenBank (ITS: PP068858, PP068859, PP446789, PP446790; act: PP079636, PP079637, PP460760, PP460761; tub2: PP079638, PP079639, PP460762, PP460763; CAL: PP079634, PP079635, PP460758, PP460759; GAPDH: PP079632, PP079633, PP460756, PP460757). Maximum likelihood phylogenetic analyses of the concatenated five genes identified all isolates as C. siamense. To pathogenicity test, the mature leaves of a healthy plant were surface disinfested using 0.1% NaClO for 3 min, rinsed three times with sterile water, and wounded. Conidia suspensions (15 µl of 1 × 106 conidia/ml) of each isolate grown on PDA at 25°C for 2 weeks were used to inoculate wounded and unwounded samples by the attached method. Control leaves were mock inoculated with sterile distilled water. Ten replications were conducted for each treatment and repeated twice. Plants were placed in a greenhouse at 25 to 30°C and 80 to 90% relative humidity. After 7 days, all inoculated leaves displayed brown lesions, while control leaves had no symptoms. Colletotrichum siamense was reisolated from inoculated tissues on PDA to complete Koch's post","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392446","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Rhizopus arrhizusi</i> causing rot of <i>Dictyophora rubrovolvata</i> in China.","authors":"Shiqi Tu, Feng Zhou, Yin Zhang, YiFan Chen, ShengQian Chao, Beibei Lü, Hailong Yu","doi":"10.1094/PDIS-08-24-1767-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1767-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Dictyophora rubrovolvata, as an edible fungus with high medicinal value, is widely cultivated in several provinces in China (Hang et al. 2012). However, between December 2023 and March 2024, a rot disease occurred in the main production area in Fengxian District, Shanghai, China (N30°93', E121°49'). The disease incidence was 25% in the affected 1.33-ha growing area. High temperatures (&gt;25℃) and poor ventilation provide favorable conditions for the spread of this disease. The disease mainly occurs at the stage of fruiting bodies formation of D. rubrovolvata. When the epidermis is damaged and broken, it becomes infested with mold, which then produces a layer of moldy rot with pus. The infected D. rubrovolvata tissues at the edge of the lesions were isolated, surface sterilized and cultured on potato dextrose agar (PDA) at 30 ℃ under dark conditions. Pure cultures were obtained by single-spore isolation. After 3 days, isolates were transferred to Czapek Yeast agar (CYA) (Samson et al, 2014). On CYA, the fungal colony consisted of white flocculent hyphae. Scanning electron microscopy analysis showed that the mycelium was white, and the internodes of the stolons formed characteristic pseudoroots, from which upwardly clustered erect, unbranched sporocarp peduncles expanded apically to form rounded sporocarp sacs, within which sporocarp spores were produced. (Hariprasath P, 2019). To confirm the identity of the pathogen, the genomic fragments for the internal transcribed spacer (ITS) and intergenic spacer (IGS) gene of the isolate were amplified by PCR (White et al. 1990; Liu XY. 2008). The resulting sequence was deposited in GenBank with accession PP951880 and PQ001670, respectively. PCR results and morphological observations indicated the isolated strain was a pure culture and the strain was designated as DIC01. Comparative results showed that the sequences with accession numbers MT603964.1 and DQ990323.1 showed high homology of 99.15% and 98.96% to the ITS and IGS sequences of Rhizopus arrhizusi DIC01, respectively. Phylogenetic analysis with ITS and IGS genes of the isolated strain and 7 Rhizopus spp. strains were performed using MEGAX with Neighbor-Joining (NJ) method. Based on the results of growth habits, morphological observations, and phylogenetic analysis, the pathogen was identified as R. arrhizusi. A spore suspension of the R. arrhizusi DIC01 (1 x107 conidia/mL) was inoculated back to healthy D. rubrovolvata. Five healthy fruit bodies of D. rubrovolvata were injected, and another five healthy morels were treated with potato dextrose broth (PDB) as controls. D. rubrovolvata was incubated at 25°C and 90% relative humidity without ventilation for 5 days. The pathogen successfully infected the D. rubrovolvata, which developed white moldy lesions similar to those of natural diseases. The controls remained healthy without any symptoms. The pathogen was reisolated from the affected lesions and identified as R. arrhizusi DIC01 based on its mor","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-10-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142392449","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}