Plant disease最新文献

{"title":"First report of target spot caused by <i>Corynespora cassiicola</i> on cotton in North Carolina.","authors":"Marcela Vasquez-Mayorga, Maria Fernanda Lainfiesta Palomo, Daisy Ahumada","doi":"10.1094/PDIS-05-25-1059-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-05-25-1059-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;On August 13, 2024, during a routine insect scouting walkthrough, symptomatic cotton leaves were collected from a field in Washington County, North Carolina (NC), and submitted to the Plant Pathology Laboratory of the corresponding author at North Carolina State University for diagnosis. The samples exhibited circular lesions with yellow halos and concentric circles in brown to reddish hues, characteristic of target spot caused by Corynespora cassiicola. Leaf tissue from lesion margins, was surface sterilized and plated on acidified potato dextrose agar (A-PDA). Plates were incubated at 28°C in the dark for seven days. Emerging fungal colonies were subcultured to obtain pure cultures. The isolates showed dark mycelial growth with a surrounding white halo and produced conidia measuring 60 µm to 120 µm long, on average, with cylindrical to obclavate morphology. Two isolates were recovered. Mycelial fragments from a pure culture were grown in malt extract broth for 48 hours before genomic DNA extraction, PCR, and sequencing. The internal transcribed spacer (ITS) region was amplified using primers ITS4 (5' TCCTCCGCTTATTGATATGC 3') and ITS5 (5' GGAAGTAAAAGTCGTAACAAGG 3') (White et al., 1990). Sequencing showed 100% nucleotide identity with Corynespora cassiicola (GenBank accession MF428364.1). To confirm pathogenicity, Koch's postulates were completed under greenhouse conditions. Cotton seedlings (DP2127 B3XF) were grown for 24 days. A 12-day-old quarter-strength PDA culture of the isolate was covered with 0.01% Tween solution and filtered through four layers of cheesecloth. The resulting spore suspension was adjusted to 4 x 104 spores/ml (Moore et al. 2021). Nine cotton plants were inoculated by pipetting 500 ul of the conidial suspension onto true leaves. Nine control plants received 0.01% Tween solution only. Leaves were covered with Kimwipes, misted with water, and enclosed in plastic bags for 48 hours. Plants were maintained at 81°F with 51.6% relative humidity. At seven days post-inoculation, inoculated plants developed characteristic C. casiicola lesions with concentric rings. The pathogen was successfully reisolated and confirmed by PCR and ITS sequencing, again showing 100% identity to C. casiicola (MF428364.1). This constitutes the first confirmed report of C. casiicola causing target spot in cotton fields in NC. The pathogen has previously been reported in Georgia (Fulmer et al., 2012), Alabama (Conner et al. 2013), Louisiana (Price et al. 2015) and Tennessee (Butler et al. 2016). In 2024, target spot was also observed and diagnosed by the Plant Disease and Insect Clinic (PDIC) in a separate cotton field in Edgecombe County, NC, with 15% incidence on variety 'DP2127 B3XF.' However, isolates from that location did not survive. The Washington County field from which Koch's postulates were completed is the same site where target spot symptoms were informally reported in 2012 with 10% incidence on an unknown variety. Also in 2012, the PDI","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144476309","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Paramyrothecium vignicola</i> Causing Leaf Spot on <i>Forsythia suspensa</i> in China.","authors":"Siru Yang, Gaolei Cai, Aiming Jiang, Zunwei Ke, Jianzhou Quan","doi":"10.1094/PDIS-03-25-0499-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-03-25-0499-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Forsythia suspensa, a medicinal plant with significant pharmacological and economic value in China (Wang and Ren 2014), is widely cultivated for its therapeutic applications. In September 2023, leaf spot symptoms were observed on one-year-old F. suspensa plants in a 0.267 ha F. suspensa plantation in Chadian Town, Yunyang District, Shiyan City, Hubei Province, China (32°46'6″N, 110°49'59″E). The plants were locally sourced from Shiyan City and propagated via seeds. Systematic sampling of 50 plants across 10 randomly selected quadrats (5 × 5 m) revealed a disease incidence of 20-30%. Symptoms included circular to irregular brown necrotic lesions (4-10 mm in diameter) with dark borders and prominent concentric rings. Notably, small dark sporodochia were observed within lesions. No canker, stem lesion, or plant mortality was observed during the survey. To isolate the pathogen, 20 symptomatic leaf samples were randomly collected from 10 infected F. suspensa plants. Diseased tissues (5 × 5 mm) excised from lesion margins were surface-sterilized with 75% ethanol for 30 s, followed by 1.5% sodium hypochlorite for 1 min, and rinsed three times with sterile distilled water. The tissues were transferred to potato dextrose agar (PDA) plates and incubated at 28°C. After 10 days, 15 morphologically similar fungal isolates L1-L15 were obtained. Colonies initially exhibited white aerial mycelia, later developing dark green to black conidial masses arranged in concentric rings with sporodochia. Microscopic analysis revealed conidiogenous cells phialidic, cylindrical to subcylindrical, hyaline, smooth, straight to slightly curved (12.03 to 15.93 × 2.01 to 2.47 μm; n=30). Conidia aseptate, hyaline, smooth, cylindrical to eliosoidal (4.95 to 6.96 × 1.07 to 2.56 μm; n=30) with rounded ends, setae arising from the stroma. These morphological characteristics were consistent with the description of Paramyrothecium sp. (Lombard et al. 2016; Withee et al. 2022). Genomic DNA of isolate L2 was extracted from fresh mycelium using DNA extraction kit (TSP001, Tsingke, Co., Ltd). The internal transcribed spacer (ITS) and calmodulin (cmdA) gene regions were amplified with primers ITS4/ITS5 (White et al. 1990) and CAL-228F/CAL2Rd (Carbone and Kohn 1999; Groenewald et al. 2013), respectively. BLASTn analysis indicated that the ITS sequence of isolate L2 (GenBank accession PP379914; 610 bp) displayed 100% identity with the type Paramyrothecium vignicola isolate SDBR-CMU376 (GenBank accession MZ373242; 601 bp). The cmdA sequence of isolate L2 (GenBank accession PP382839; 684 bp) exhibited 99.42% identity to P. vignicola isolate SDBR-CMU374 (GenBank accession OM810410; 942 bp). Results of double-loci phylogenetic tree analyses based on ITS and cmdA showed isolate L2 clustered within the same branch as P. vignicola. Therefore, based on morphological characteristics and molecular phylogeny, isolate L2 was identified as P. vignicola. To evaluate pathogenicity, three healthy leave","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144476305","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Agroathelia</i> (syn. <i>Sclerotium</i>) <i>rolfsii</i> associated with Southern blight disease of <i>Daphne tangutica</i> (Gansu Ruixiang) in China.","authors":"Zunwei Ke, Gaolei Cai, Fan Zhang, Siru Yang, Mengting Cheng, Wei Lu, Yafei Chen","doi":"10.1094/PDIS-02-25-0254-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-02-25-0254-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Daphne tangutica Maxim. (Thymelaeaceae) is widely cultivated in China for its medicinal properties including promoting blood circulation, relieving pain, and dispelling wind to eliminate dampness (Liu et al. 2009). In August 2022, stem rot disease was observed on 1-to 5-year-old D. tangutica (Gansu Ruixiang) plants, with a disease incidence rate of 10% in a 40 m2 greenhouse located in Shiyan City, Hubei Province, China. The average temperature ranged from 28°C to 33°C, with relative humidity was 60% to 80%. The disease occurred during the fruiting period and affected plants regardless of age. White mycelia appeared at the crown of the stem at the soil line, and extended upward along the stem. Both young and mature leaves curled, wilted, and fell prematurely. The xylem of infected plants turned dark brown and softened progressively, eventually leading to plant death. A suspected fungal pathogen was isolated from two symptomatic plants. Fragments of mycelia were transferred onto potato dextrose agar (PDA) plates with a sterile dissecting needle and incubated at 28°C for 2 to 3 days. Colonies were purified using the hyphal-tip method and transferred to fresh PDA plates for morphological observation. White mycelia grew at a rate of 17.7 to 23.7 mm/day (n=16), and hyphae were hyaline with typical clamp connection under ×40 magnification. Light yellow sclerotia began forming after five days and gradually turned dark brown. On average, 65.65 ± 4.33 (n = 50) spherical, dark brown sclerotia, each with a mean diameter of 1.64 ± 0.29 mm (n=50), developed on each Petri dish after 18 days of incubation. Based on morphological characteristics, the isolates were tentatively identified as Agroathelia (=Sclerotium) rolfsii (Sacc.) Redhead & Mullineux (Amylocorticiaceae) (Redhead and Mullineux). Two representative isolates, HJBJ-5 and HJBJ-9, were selected for molecular identification. Genomic DNA was extracted using a DNA extraction kit (TSP101-200, Tsingke Biotech Co., Ltd.), and PCR amplification was performed using the internal transcribed spacer ITS primers (ITS1 and ITS4) (White et al. 1990) and the large subunit ribosomal LSU primers (LR0R and LR5) (Xu et al. 2010). The PCR products were sequenced and analyzed using BLAST with the current available sequences in NCBI. The ITS sequences of HJBJ-5 (OR578406/667bp) and HJBJ-9 (PP231038/659bp) shared 99.1% and 98.8% similarity, respectively, with A. rolfsii A8.2 (GU080230/685bp) and A. rolfsii NB2 (MN071108/658bp). The LSU sequences of HJBJ-5 (OR591284/913bp) and HJBJ-9 (PP231039/897bp) showed 99.8% and 99.9% similarity with A. rolfsii Penampang (OP809607/942bp) and A. rolfsii MY17B-1 (OP658955/922bp). Phylogenetic analysis using the maximum likelihood method confirmed that the two isolates (HJBJ-5 and HJBJ-9) clustered with other known A. rolfsii strains. To confirm pathogenicity, healthy, asympomatic eight-month-old D. tangutica (Gansu Ruixiang) plants were transplanted into pots containing sterilized so","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144476300","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Botrytis cinerea</i> Causing Gray Mold on <i>Cremastra appendiculata</i> in China.","authors":"Xiaofang Chen, Xiangyu Zhang, Lu Huang, Yao Feng, Weiyu Jia, Yuetong Ning","doi":"10.1094/PDIS-02-25-0285-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-02-25-0285-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Cremastra appendiculata (D. Don) Makino is a perennial rare medicinal plant in the family Orchidaceae. The dry pseudobulb is used as the medicinal part, exhibiting a range of pharmacological activities, including anti-tumor, anti-inflammatory, and antioxidant effects, among others (Liu et al., 2021; Jiang et al., 2022). In March 2024, a gray mold disease was observed in C. appendiculata fields planted in Dafang County (27°23'17.18″ N, 105°73'95.94″ E, 1774.6 m), Guizhou Province, China. The disease started from the leaf tip or edge and gradually formed large, irregular disease patches. Leaves curled and withered, with a dense gray mold layer on the surface, approximately 30% to 70% of the plants were affected. Twenty symptomatic leaf segments (5 × 5 mm2) were aseptically dissected from lesion margins, surface-sterilized with 75% ethanol for 30 s, triple-rinsed in distilled water, and maintained on PDA medium at 25℃ for three days. Twenty-one morphologically-identical isolates were single-spored. Initially, the mycelium appeared as sparse, white, radiating in growth, which later developed into gray, velvety colonies. Irregular black sclerotia formed at later stages of development. The conidiophores frequently branch and produce numerous conidia, forming grape spikes. The conidia are colorless single spores, oval, ranging from 8.15-12.59 μm × 6.78-9.83 μm (av.= 8.32 × 10.70, n = 50). The morphological characteristics closely resembled the description of Botrytis cinerea (Li et al., 2022). In addition, the internal transcribed spacer region (ITS), heat shock protein (HSP60), RNA polymerase II (RPB2), and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) genes were amplified by PCR and sequenced (Staats et al., 2005; White et al., 1990). The sequences were analyzed using RAxML-HPC BlackBox v.8.2.12, MrBayes v.3.2.7a and PAUP on ACCESS4.a168 on the CIPRES website for maximum likelihood (ML), maximum parsimony (MP) and Bayesian (BI) analyses. Two representative strains (DJS 01 and DJF 003) were registered in GenBank. BLASTn analysis showed &gt;99% identity with Botrytis cinerea in GenBank: ITS: 100% (PP859488 versus KY817366 = 519/519 bp; PQ870055 versus KY817366 = 519/519 bp); RPB2: 99% (PP892380 versus AJ745676 = 1043/1044 bp; PQ776262 versus AJ745676 = 1089/1098 bp); G3PDH: 99-100% (PP868420 versus AJ705004 = 886/887 bp; PQ776260 versus AJ705004 = 886/886 bp); HSP60: 99-100% (PP892379 versus AJ716065 = 886/886 bp; PQ776261 versus AJ716065 = 975/976 bp). The multigene phylogenetic tree indicated that the two strains clustered with B. cinerea in a single clade. Pathogenicity tests were performed by spraying 20 C. appendiculata plants with conidial suspension (1×10⁵ spores/mL) of the DJS 01 and DJF 003 strains, while a control group of 6 plants was inoculated with distilled water. The plants were cultured under controlled conditions of 20°C and 90% relative humidity. After 10 days, spore-treated plants developed gray mold-like lesions, while controls","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144476301","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of Powdery Mildew Caused by <i>Erysiphe alliariicola</i> on Pennycress (<i>Thlaspi arvense</i>) in North America.","authors":"Julia Xiuling Zhang, Nicholas Greatens, Brett Arenz, Jennifer Flynn, Jim A Anderson","doi":"10.1094/PDIS-10-24-2055-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-10-24-2055-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Thlaspi arvense L., or pennycress, is an annual plant in Brassicaceae. It has recently been domesticated as a winter oilseed cover crop for the ultra-low carbon fuel feedstock market (Chopra et al. 2020). In Jan. 2023, severe powdery mildew occurred on greenhouse-grown plants in St. Paul, Minnesota. Disease severity reached 100% on the most susceptible lines. Mycelia and conidia were first observed on the adaxial surface of the lower leaves. Colonies coalesced to form a dense, opaque layer on leaves, stems, pods, and flowers. Infected plant parts senesced prematurely, and seed yield and viability were substantially reduced. Mycelia were unpigmented and smooth. Conidiophores were straight, colorless, erect, cylindrical, 50-93 µm (mean 68.9 µm) long, and composed of 3 to 4 cells. Conidiophore foot cells were cylindrical and 14.3-29.6 x 4.1-6.7 µm (mean 21.8 x 5.9 µm). Conidia were cylindric-doliiform, singly borne, and 22.9-43.1 x 11.3-20.3 µm (mean 34.6 x 15.7 µm). Chasmothecia were observed when plants began to senesce, and were round, 100-120 µm in diameter, dark brown at maturity, and with simple appendages 40-260 µm in length. Asci were ovoid-saccate containing 3-6 colorless ascospores approximately 20-22.5 x 10-12.5 µm in size. To fulfill Koch's postulates and develop an isolate for later investigations, a piece of leaf with a single colony was gently pressed on two leaves of a 3-week-old T. arvense plant \"MN106\". The inoculated and control plants were incubated in a greenhouse at 22°C (day) and 18°C (night). The reisolated Erysiphe alliariicola was identical in symptoms, morphology, and ITS as the original isolate, thus confirming Koch's postulates. Control plants remained symptomless. The ITS region, and segments of the LSU, CAM, GADPH, GS, and RPB2 loci were amplified by PCR following Bradshaw et al. (2022a, 2022b). Respectively, the GenBank accessions are OR195529, PP499013, PQ213024, PQ213025, PQ213026, and PQ213027, with primers available within accessions. The sample was submitted to the University of Minnesota Bell Museum (MIN984734). Reference sequences from Bradshaw et al. (2022a; 2024) were downloaded from NCBI, and sequences were aligned and concatenated. A maximum likelihood tree was inferred with iqtree2 (Minh et al. 2020) with 1000 bootstraps and the analysis partitioned by locus. A sample of Erysiphe intermedia (HAL 3381F) was selected as an outgroup (Bradshaw et al. 2024). The tree was formatted using the R package ggtree (Yu et al. 2017). Phylogenetic analysis supports the determination of our sample as Erysiphe alliariicola (Fig 1), a recently described species formerly within E. crucifearum sensu lato (Bradshaw et al. 2024) and previously only reported on garlic mustard (Alliaria petiolata) in Europe. Garlic mustard is an invasive weed in North America, where it has been reported diseased by powdery mildew since at least 2004 (Enright and Cipollini, 2007). Notably, the ITS sequence reported from powdery mildew on gar","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-23","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144476308","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Monitoring the Occurrence and Distribution of Stewart's Wilt of Maize in Iran.","authors":"Hosna Alvandi, Seied Mohsen Taghavi, Sadegh Zarei, Maryam Ansari, Maede Heidari, Amal Fazliarab, Milad Aeini, Perrine Portier, Ebrahim Osdaghi","doi":"10.1094/PDIS-03-25-0509-SR","DOIUrl":"https://doi.org/10.1094/PDIS-03-25-0509-SR","url":null,"abstract":"<p><p>Stewart's wilt of maize caused by the Gram-negative bacterium Pantoea stewartii subsp. stewartii is one of economically important diseases of the crop around the globe. The disease has not yet been reported in Iran. Following preliminary observation of suspected symptoms on maize plants in Southeastern Iran in 2019, a four-year comprehensive field survey and sampling program was initiated across maize growing areas in the country to monitor the occurrence and distribution of the disease. During 2019-2022, 180 maize fields were surveyed from which 400 symptomatic and asymptomatic maize samples were collected. Among dozens of bacterial strains isolated from leaves and stems of maize plants, 22 strains phenotypically resembled those of Pantoea spp. Species-specific PCR and multilocus phylogenetic analyses using the sequences of atpD, gyrB, infB, and rpoB genes showed that P. stewartii subsp. stewartii is the causal agent of Stewart's wilt in Iran. All strains induced leaf chlorosis and plant stunting on maize plants under greenhouse conditions 7-15 days post inoculation; confirmed with accomplishment of Koch's postulates. These 22 strains were isolated in Bushehr, Fars, Hormozgan, Kermanshah, Khuzestan, Kohgiluyeh-Boyer Ahmad, and Sistan-Baluchistan provinces. Results of the present study confirmed the occurrence of P. stewartii subsp. stewartii causing Stewart's wilt of maize in Iran. Occurrence of Stewart's wilt on maize in Iran can lead to yield reduction, trade restrictions, increased control costs, and threats to food security. Considering quarantine status of the pathogen in Iran, strict inspections are warranted to combat potential threats due to Stewart's wilt epidemics in the country.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144317629","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of Postharvest Fruit Rot in Longan Caused by <i>Botrytis cinerea</i> in China.","authors":"Xiaoqiong Guo, Renjie Yang, Qian Han, Jialei Jin, Yanan Zhang, Yanguo Xu","doi":"10.1094/PDIS-04-25-0796-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-04-25-0796-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Longan (&lt;i&gt;Dimocarpus longan&lt;/i&gt; Lour.), a Sapindaceae tropical fruit, is mainly cultivated in China, Thailand, and Vietnam. From 2015-2017, China dominated global production with 1,919.4 thousand metric tons annually (55.7% of total) (Rakariyatham et al., 2020). On Jan 5, 2025, soft rot of longan fruits (10% incidence) was found in the Fruit Wholesale Market of Qujing City (25.54°N, 103.80°E), Yunnan Province, China. The infected fruits exhibited brown epidermis with completely whitened and decayed internal tissues, accompanied by a fermented alcoholic odor. The margins of the infected fruits were cut into small pieces of 0.5 × 0.5 cm, soaked in 75% ethanol for 3 minutes, then rinsed 5 times with sterile water, and placed on potato dextrose agar (PDA), followed by incubation in the dark at 28 °C. After 24h, white mycelia emerged around the tissues, hyphal tip transfer method was used for strain purification on PDA. Four days later, the colony covered the entire 9-cm-diameter PDA and turned gray. Obvious gray sclerotia appeared in the center of the colony after 8 days. Scattered sclerotia appeared around the colony after 14 days. A large number of scattered grayish-black sclerotia were observed after 20 days. Six similar strains were isolated, with a representative isolate YC1126 subjected to morphological and molecular characterization. Morphological analysis revealed septate conidiophores with irregular inter-septal distances, apically branched to form grape-like conidial clusters. The conidia are unicellular, ovoid or ellipsoidal, with a size range of 5.1 to 9.3 μm × 6.5 to 15.4 μm (n = 50). The sclerotia are gray or grayish-black, round or irregular in shape, and the size 0.23 to 1.06 cm × 0.25 to 1.44 cm (n = 50). The morphological characteristics of this isolate are similar to &lt;i&gt;Botrytis cinerea&lt;/i&gt; (Liu et al., 2024). Molecular identification was conducted by sequencing the internal transcribed spacer (ITS) region of rDNA and three nuclear protein-coding genes (glyceraldehyde-3-phosphate dehydrogenase [&lt;i&gt;G3PDH&lt;/i&gt;], heat-shock protein 60 [&lt;i&gt;HSP60&lt;/i&gt;], and DNA-dependent RNA polymerase subunit [&lt;i&gt;RPB2&lt;/i&gt;]) using primers of ITS1/ITS4, G3PDHfor/G3PDHrev, HSP60for/HSP60rev, and RPB2for/RPB2rev, respectively (Staats et al., 2005). BLAST analysis showed that this isolate (GenBank accession nos. PQ857502, PV472625, PV472626, and PV472627 for ITS, &lt;i&gt;G3PDH&lt;/i&gt;, &lt;i&gt;HSP60&lt;/i&gt;, and &lt;i&gt;RPB2&lt;/i&gt;, respectively) shared 99.89% to 100% identity with &lt;i&gt;Botrytis cinerea&lt;/i&gt; (GenBank accession nos. PV230480 [515/515 bp], MF461628 [922/923 bp], MF461629 [1011/1011 bp], and MN159929 [1133/1133 bp], respectively). A maximum-likelihood and Bayesian posterior probability-based phylogenetic analyses with the concatenated sequences placed YC1126 in the clade of &lt;i&gt;B. cinerea&lt;/i&gt;. Thus, isolate YC1126 was identified as &lt;i&gt;B. cinerea&lt;/i&gt;. For pathogenicity test, 10 needle-wounded longan fruits were inoculated with 7-day-old fungal discs (with 10 unwounded ","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144317626","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Fungicide Application on Alternate Host Barberry has Significant Roles in Declining Population Genetic Diversity and the Risk of Emerging New Races of <i>Puccinia striiformis</i> f. sp. <i>tritici</i>.","authors":"Zejian Li, Xu Chen, Jing Xu, Fei Liu, Yumeng Bian, Zhimin Du, Xinyao Ma, Mudi Sun, Yuanyuan Zhao, Zhensheng Kang, Jie Zhao","doi":"10.1094/PDIS-12-24-2727-RE","DOIUrl":"https://doi.org/10.1094/PDIS-12-24-2727-RE","url":null,"abstract":"<p><p><i>Puccinia striiformis</i> f. sp. <i>tritici</i> (<i>Pst</i>) is a destructive pathogen renowned for its dual reproductive modes, asexual stage on wheat and sexual stage on barberry (<i>Berberis</i>) that makes wheat cultivars vulnerable to newly emerging races. However, little has been known impact of treatment on barberry plants on declining population genetic diversity and race composition. In this study, we selected six barberry-wheat coexisting sites in which <i>Pst</i> occurs sexually, as treatment and control group for experimental purpose. The treatment group were treated with triadimefon fungicides on barberry at early pycnial stage to suppress the sexual reproduction. Conversely, the control group represented sexual reproduction without fungicide application. <i>Pst</i> populations from wheat fields closed to barberry with/without fungicide treatment were phenotype on Chinese differentials and genotype using a DNA microarray. The results showed treatment population displayed a lower heterozygosity level (<i>F_hom</i> = -0.36945, <i>Tajima's D</i> = 0.285033), and a lower genetic diversity (<i>π</i> = 0.000156053) compared to control population (<i>F_hom</i> = -0.41745, <i>Tajima's D</i> = 0.955451, <i>π</i> = 0.000184483), and a significant difference was observed between both populations (<i>P</i> < 0.001; <i>P</i> < 0.05). Treatment population was identified 17 new races and 3 known races, and control population was identified 46 new races and 8 known races. Treatment population (<i>α</i> = 4.644) showed the standard races diversity lower than control population (<i>α</i> = 5.194) based on a set of 25 <i>Yr</i>-single gene lines. Our results showed a significant impact of fungicide application on barberry to minimize emergence of new races and the level of genetic diversity. It provided guidance to growers, emphasizing the importance of timely fungicide application on barberry to ensure the long-term resistance durability of wheat cultivars against stripe rust.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144317627","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Leaf spot disease caused by <i>Phyllosticta capitalensis</i> on mango in Guangxi, China.","authors":"Sifan Zhao, Qili Li, SuiPing Huang, Xiaolin Chen, Yu Zhang, Wei Li, Lihua Tang","doi":"10.1094/PDIS-05-25-0951-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-05-25-0951-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Mango (Mangifera indica L.), tropical fruit renowned for its rich flavor and nutritional benefits, is extensively cultivated in southern China (Wang et al. 2023). In July 2023, leaf spots were observed in a mango plantation located in Tianyang, Guangxi, China (106°22'-107°09'E, 23°29'-24°07'N), with ~20% incidence across surveyed fields. Affected leaves exhibited 20-80% necrotic coverage, with subcircular or irregular yellowish-brown lesions gradually expanding into brown irregular areas surrounded by yellow halos. Symptomatic leaves were collected from three orchards, and 5 × 5 mm sections were excised from lesion margins and surface sterilized by immersion in 75% ethanol for 15 s and 2% sodium hypochlorite for 1 min, followed by three sterile distilled water rinses. Disinfected tissues were placed on potato dextrose agar (PDA) and incubated at 28°C under 12-h photoperiod cycles for 5 days. A total of 75 morphologically similar isolates were obtained, and three representative strains (TY6-1, TY8-1, TY9-1) were selected for characterization. Colonies displayed dark green pigmentation with granular textures and irregular white margins. Conidiomata were black, immersed or semi-immersed, subglobose to ellipsoidal, solitary or aggregated on the stroma, with circular ostioles. Conidiogenous cells appeared stick-shaped with apical constrictions, producing hyaline, unicellular, ovoid or subglobose conidia (6.0-8.5 × 8.5-13.3 μm; n=90) bearing single apical appendages. Morphological characteristics of the three isolates aligned with descriptions of Phyllosticta spp. (Wikee et al. 2013). For molecular identification, the internal transcribed spacer (ITS) region, actin (ACT), and translation elongation factor (TEF) genes were amplified and sequenced using primer pairs ITS-ITS1/ITS4, ACT-512F/783R, and TEF-728F/986R, respectively (White et al. 1990; Carbone et al. 1999). Sequences were deposited in GenBank under accession numbers PV259393-PV259395 (ITS); PV268325-PV268327 (ACT); and PV268328-PV268330 (TEF). BLASTN analyses revealed that all sequences exhibited over 99% identity with sequences (accessions JF261465, JF343647, JF261507) of the type strain of P. capitalensis (CBS 128856). Maximum likelihood phylogeny (RAxML v8.2.10) of concatenated sequences placed all isolates within the P. capitalensis clade with strong bootstrap support. Pathogenicity assays were conducted on leaves of two-year-old mango plants in a greenhouse. Both wounded and intact leaves (20 leaves/plant, 3 plants/treatment) were inoculated with 20 μL of conidial suspension (10⁶ spores/mL), while controls received 0.05% Tween 80. Plants were covered with plastic bags to maintain high humidity. After 14 days, wounded and inoculated leaves developed lesions matching field observations, whereas control and unwounded leaves remained asymptomatic. The pathogenicity test was repeated three times with similar results. Koch's postulates were fulfilled by re-isolation of P. capitalensis fro","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144317628","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Phenotypic and genotypic characterization of novel strains of spinach downy mildew pathogen.","authors":"Chunda Feng, Pauline F Ficheux, Maria I Villarroel-Zeballos, Vanina Castroagudin, Hannah Zima, Kurt Lamour, Kelley Jean Clark, Steven J Klosterman, James Correll","doi":"10.1094/PDIS-01-25-0064-RE","DOIUrl":"https://doi.org/10.1094/PDIS-01-25-0064-RE","url":null,"abstract":"<p><p>Downy mildew, caused by the obligate pathogen <i>Peronospora effusa</i>, can have a devastating economic impact on spinach production. Growing resistant cultivars is the most economical way to manage this disease, and only viable management practice for organic spinach production. However, rapidly emerging races or novel strains may result in a breakdown of the resistance deployed. It is therefore critical to monitor the population dynamics of <i>P. effusa</i> and to determine the disease reactions of newly released cultivars to the new races and novel strains. In this study, 74 isolates of <i>P. effusa</i> were examined for their pathogenicity on differential host cultivars, resulting in the identification of three new races and 18 novel strains with unique virulence pathotypes. Of those identified, race 19 of <i>P. effusa</i> could infect many widely grown cultivars with resistance to <i>P. effusa</i> races 1-17. Targeted sequencing of DNA isolated from lesions of <i>P. effusa</i> race19 isolates revealed genetic variations among isolates and also within isolates of <i>P. effusa</i> race 19. The isolates showed either no genetic variation (only one genotype was found from multiple lesions of an isolate tested), limited, or abundant genetic variation (multiple genotypes were found within an isolate tested). Additionally, 70 commercial spinach cultivars were tested with two <i>P. effusa</i> races, 18 and 19, and four novel strains. The results of this study are helpful for growers to select suitable cultivars for production, and for breeders to develop downy mildew resistant cultivars.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144317630","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}