First report of target spot caused by Corynespora cassiicola on cotton in North Carolina.

Abstract

On August 13, 2024, during a routine insect scouting walkthrough, symptomatic cotton leaves were collected from a field in Washington County, North Carolina (NC), and submitted to the Plant Pathology Laboratory of the corresponding author at North Carolina State University for diagnosis. The samples exhibited circular lesions with yellow halos and concentric circles in brown to reddish hues, characteristic of target spot caused by Corynespora cassiicola. Leaf tissue from lesion margins, was surface sterilized and plated on acidified potato dextrose agar (A-PDA). Plates were incubated at 28°C in the dark for seven days. Emerging fungal colonies were subcultured to obtain pure cultures. The isolates showed dark mycelial growth with a surrounding white halo and produced conidia measuring 60 µm to 120 µm long, on average, with cylindrical to obclavate morphology. Two isolates were recovered. Mycelial fragments from a pure culture were grown in malt extract broth for 48 hours before genomic DNA extraction, PCR, and sequencing. The internal transcribed spacer (ITS) region was amplified using primers ITS4 (5' TCCTCCGCTTATTGATATGC 3') and ITS5 (5' GGAAGTAAAAGTCGTAACAAGG 3') (White et al., 1990). Sequencing showed 100% nucleotide identity with Corynespora cassiicola (GenBank accession MF428364.1). To confirm pathogenicity, Koch's postulates were completed under greenhouse conditions. Cotton seedlings (DP2127 B3XF) were grown for 24 days. A 12-day-old quarter-strength PDA culture of the isolate was covered with 0.01% Tween solution and filtered through four layers of cheesecloth. The resulting spore suspension was adjusted to 4 x 104 spores/ml (Moore et al. 2021). Nine cotton plants were inoculated by pipetting 500 ul of the conidial suspension onto true leaves. Nine control plants received 0.01% Tween solution only. Leaves were covered with Kimwipes, misted with water, and enclosed in plastic bags for 48 hours. Plants were maintained at 81°F with 51.6% relative humidity. At seven days post-inoculation, inoculated plants developed characteristic C. casiicola lesions with concentric rings. The pathogen was successfully reisolated and confirmed by PCR and ITS sequencing, again showing 100% identity to C. casiicola (MF428364.1). This constitutes the first confirmed report of C. casiicola causing target spot in cotton fields in NC. The pathogen has previously been reported in Georgia (Fulmer et al., 2012), Alabama (Conner et al. 2013), Louisiana (Price et al. 2015) and Tennessee (Butler et al. 2016). In 2024, target spot was also observed and diagnosed by the Plant Disease and Insect Clinic (PDIC) in a separate cotton field in Edgecombe County, NC, with 15% incidence on variety 'DP2127 B3XF.' However, isolates from that location did not survive. The Washington County field from which Koch's postulates were completed is the same site where target spot symptoms were informally reported in 2012 with 10% incidence on an unknown variety. Also in 2012, the PDIC confirmed C. cassiicola in variety 'PHY 499 WRF' in Chowan County, with 50% field incidence. This current confirmation supports improved monitoring and management of this emerging disease.