Plant disease最新文献

{"title":"Horizontal and Vertical Distribution of <i>Clarireedia</i> spp. in Asymptomatic and Symptomatic Creeping Bentgrass Cultivars.","authors":"Glen Groben, Brian Schaefer, Bruce B Clarke, James A Murphy, Patrick Purdon, Paul Koch, Ning Zhang","doi":"10.1094/PDIS-08-23-1570-RE","DOIUrl":"10.1094/PDIS-08-23-1570-RE","url":null,"abstract":"<p><p>Dollar spot is an important disease of both cool- and warm-season turfgrasses caused by six fungal species in the genus <i>Clarireedia</i>, yet the ecology and epidemiology of these pathogens remains poorly understood. The goal of this study was to determine the distribution of <i>Clarireedia</i> in asymptomatic and symptomatic creeping bentgrass (<i>Agrostis stolonifera</i>) in the field using a previously developed quantitative PCR assay. To determine the horizontal distribution of the pathogen, the abundance of <i>Clarireedia</i> spp. was measured in leaf and crown tissue from 90, 1-cm-diameter cores spaced 10 cm apart in May 2019 and 2020 (asymptomatic tissue) and August 2019 and July 2020 (symptomatic tissue). Thirty-seven to 69% of cores sampled from asymptomatic turfgrass and 77 to 95% of cores taken from symptomatic turfgrass yielded positive detections for <i>Clarireedia</i>. Spatial analysis indicated that <i>Clarireedia</i> was randomly distributed in the field in both asymptomatic and symptomatic turfgrass. To assess the vertical distribution of the pathogen, the abundance of <i>Clarireedia</i> was measured in the foliar, crown, and thatch layers of 39, 1-cm-diameter × 2.5-cm-deep cores of creeping bentgrass maintained at fairway height (9.5 mm) during 2019 and 2020. <i>Clarireedia</i> was most abundant in foliar tissue, followed by crown tissue and thatch (lowest abundance) throughout the 2-year study. Both studies provide evidence that <i>Clarireedia</i> is widely distributed in turfgrass swards prior to symptom development and can persist within turfgrass as an endophyte. These findings will improve our understanding of <i>Clarireedia</i> epidemiology and may lead to more sustainable dollar spot management.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-08","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141604018","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Scab Intensity in Pecan Trees in Relation to Hedge-Pruning Methods.","authors":"Clive H Bock, David I Shapiro-Ilan, Michael W Hotchkiss, Pedro F S Toledo, Lenny Wells, Jason M Schmidt, Cristina Pisani, Angelita L Acebes-Doria","doi":"10.1094/PDIS-10-23-2247-RE","DOIUrl":"10.1094/PDIS-10-23-2247-RE","url":null,"abstract":"<p><p>Pecan is a valuable nut crop cultivated in the southeastern United States. Among the major yield-limiting factors in the region is scab, caused by the plant pathogenic fungus <i>Venturia effusa</i>. Managing scab in tall trees (15 to 25+ m) in pecan orchards is challenging because of the limitations of getting sufficient spray coverage throughout the canopy. We explored the effects of hedge pruning on scab in three orchards: 14-m-tall cv. Desirable trees winter hedge pruned on alternate sides to 11 m (site 1), 18-m-tall cv. Stuart trees hedge pruned on both sides simultaneously to 11 m (site 2), and 15-m-tall cv. Caddo trees winter hedge pruned in winter versus summer to 11 m (site 3). At site 1 and 2, hedge-pruned trees were compared with nonpruned control trees. All trees received recommended fungicide applications to control scab via an air-blast sprayer. Disease incidence and/or severity was assessed at different sample heights on shoots, foliage, and fruit during three seasons (2020, 2021, and 2022). At site 1 the hedge-pruned trees often had significantly or numerically more severe scab on foliage and fruit compared with the control trees, although the differences were mostly small. The frequency of mature fruit with scab severity <10% was greatest on control trees in 2021 and 2022. At site 2, there were few differences between hedge-pruned and control trees (on fruit, scab severity was either significantly less on hedge-pruned trees or not different from the control), but the frequency of mature fruit with scab severity <10% was consistently greatest on hedge-pruned trees. At site 3, scab intensity was low, and there were no significant differences in scab severity between winter- and summer-pruning treatments. At sites 1 and 2, there was generally more severe scab at greater sample heights compared with low in the canopy. At site 3 there was little effect of height on disease. The benefit of hedge pruning likely increases with tree height in scab-susceptible cultivars. If a tree is taller than ∼15 m, a greater proportion of the fruit will be within reach of efficacious spray coverage from air-blast sprayers.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-08","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141727609","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"<i>Fusarium oxysporum</i> f. sp. <i>apii</i> Race 4 Threatening Celery Production in South Florida.","authors":"Tarciso A Ferreira Junior, Larissa C Ferreira, Vitor A S Moura, Katia V Xavier","doi":"10.1094/PDIS-01-24-0075-RE","DOIUrl":"10.1094/PDIS-01-24-0075-RE","url":null,"abstract":"<p><p>Fusarium wilt, caused by <i>Fusarium oxysporum</i> f. sp. <i>apii</i> (<i>Foa</i>), is a vascular disease affecting celery. This soilborne pathogen is classified into four distinct pathogenic races: 1, 2, 3, and 4. Notably, race 4 emerges as the most virulent, representing the latest evolutionary development of this pathogen, which was first reported in 2013 in California. In 2022, celery plants in South Florida exhibited typical Fusarium wilt symptoms, with the disease reaching a 100% incidence and causing yield losses ranging from 20 to 100%. Given the significance of celery as a vegetable crop and the severity of this outbreak, the primary objective of this study was to identify and characterize the causal agent of Fusarium wilt in South Florida. The second goal aimed to test the pathogenicity and virulence of the <i>Fusarium</i> isolates from Florida on celery and parsley plants. Using race-specific primers and dual-loci phylogenetic analyses, the isolates surveyed in this study were identified as <i>Foa</i> race 4. Pathogenicity assays in the greenhouse showed that the <i>Foa</i> race 4 isolate from celery induced disease not only on the two celery cultivars (Duda 30 and Duda 71) but also on two commonly cultivated parsley varieties (curly and Italian). Our study also revealed that the <i>Foa</i> race 4 significantly (<i>P</i> < 0.05) affected plant health attributes in all cultivars, including plant height, total plant weight, and root weight. Interestingly, the pathogen exhibited higher (<i>P</i> < 0.0001) virulence on parsley than celery based on vascular discoloration. These findings strongly indicate the urgency of comprehending and managing Fusarium wilt on celery and related crops. Furthermore, the ability of <i>Foa</i> race 4 to affect different plant species highlights a potential threat to agricultural production, emphasizing the need for proactive measures to mitigate the impact of this virulent pathogen.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-07","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141634210","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Expansion of the Host Range of <i>Xanthomonas euroxanthea</i>: First Occurrence in Sunflower in Bulgaria.","authors":"Eva Garcia, Fabiana Soares, Cristiana Oliveira Rodrigues, João Trovão, Joël F Pothier, Alexandra Camelo, Christophe Espirito Santo, Dian Dragnev, Eli Petrova, Joana Costa, Svetoslav Ganchev Bobev","doi":"10.1094/PDIS-08-24-1691-SC","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1691-SC","url":null,"abstract":"<p><p>Sunflower is a short-season crop of the Asteraceae family and the Helianthus genus and is the fourth most important oilseed crop in the world. During a field campaign, unusual symptoms (necrosis and longitudinal cracking of the petiole) were observed in a sunflower crop grown in the region of Kavarna (Dobrich district, Bulgaria) and strains of the genus Xanthomonas were isolated. Results based on phylogenetic and phylogenomic analyses showed that they clustered with Xanthomonas euroxanthea CPBF 424T species, a pathogenic strain isolated from walnut buds in Portugal and responsible for causing walnut bacterial blight (WBB). The sunflower strain showed five out of eight X. euroxanthea-specific markers (XEA4-XEA8), a pattern also observed in some strains isolated from Solanum lycopersicum, Phaseolus vulgaris and rainwater sources, reinforcing the emergence of a recent lineage-driven by evolutionary adaptations to new plant hosts. This is the first report of X. euroxanthea in sunflower crops in Bulgaria, which represents a potential threat to production and its distribution should be monitored.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142591199","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Diversity of Oomycetes From Alabama Cotton Soils Using Culture-Independent Methods.","authors":"Morgan Bragg, Oluwakemisola Olofintila, Zachary Albert Noel","doi":"10.1094/PDIS-05-24-1040-SC","DOIUrl":"https://doi.org/10.1094/PDIS-05-24-1040-SC","url":null,"abstract":"<p><p>Seedling disease management recommendations rely on comprehensive identification of the pathogens. A recent manuscript isolated oomycetes from diseased cotton (<i>Gossypium hirsutum</i> L.) roots to identify the species associated. However, culture-dependent surveys may miss species because of the microbiological medium and work required to isolate and maintain all cultured organisms. Alternatively, culture-independent methods using PCR amplification and high-throughput sequencing can identify species' presence and relative abundance, including obligate pathogens and rare members of communities. We used culture-independent sequencing from the same cotton soils in the culture-based survey to determine the oomycete species in oomycete-containing soils. The results of the two methods were generally similar regarding the species identified. Similarly to the culture-based method, <i>Globisporangium irregular</i> accounted for 24% of the relative abundance and was encountered in all fields sequenced. In contrast, we identified three operational taxonomic units matching <i>Globisporangium ultimum</i>, but accounted for less than 0.06% of total relative abundance, potentially explaining why it was not isolated from cotton roots in the original survey. <i>Phytophthora nicotianae</i> was identified in soils but not at the concentrations recorded in the culture-based study. The results of this study, combined with the results of the culture-based survey, demonstrate the most comprehensive identification of oomycetes associated with cotton in the cotton belt and the oomycetes related to seedling disease. The combined results will be essential for future research into the specific pathogen species mentioned and stimulate similar research in other states.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142591185","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of Powdery Mildew Caused by <i>Golovinomyces ambrosiae</i> on <i>Symphyotrichum subulatum</i> in China.","authors":"Huafeng Liu, Tingfu Zhang, Yingqing Luo, Guoqin Wen, Na Li","doi":"10.1094/PDIS-06-24-1312-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-06-24-1312-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Symphyotrichum subulatum (Michx.) G. L. Nesom (syn. Aster subulatus), an annual herb in the Asteraceae family, is native to North America. Nowadays, it has become an invasive weed in several provinces of China, including Jiangsu, Zhejiang, and Sichuan (Li and Xie, 2002). Despite being invasive, this species holds significance in Chinese medicine, where it is used for the external treatment of eczema and swollen sore poison (Hu, 2020). In June 2023, symptoms of powdery mildew were observed in S. subulatum populations in Deyang and Nanchong, Sichuan Province, China. About 32.73% among 55 surveyed S. subulatum plants showed signs of infection. Symptoms initially appeared as small, scattered white powdery patches on the leaves, which enlarged and coalesced over time. Subsequently, hyphal growth forming extensive conidia covered up to 90% of the leaf area on both surfaces (Fig. S1A, B), and the infected leaves withered and fell off (Fig. S1A). A specimen was archived at China West Normal University (SsPM-ZL). Conidiophores were cylindrical and erect, 66.4 to 183.2 µm (avg. 108.2±40.8 μm) in length (n=30) (Fig. S1C). Conidia, produced singly, were ellipsoid-ovoid to nearly cylindrical, measuring 29.5 to 36.7 μm in length (avg. 32.9±2.6 μm) and 16.0 to 19.9 μm in width (avg. 17.4±1.3 μm), lacking distinct fibrosin bodies (n=30) (Fig. S1D). Under a scanning electron microscope, turgid conidia displayed reticulate wrinkles on the surface, with gentle contractions or bulges at both poles (Fig. S1E, F). Based on these characteristics, the powdery mildew fungus was consistent with the genus Golovinomyces (Bradshaw et al. 2022a). To confirm the identity of the causal fungus of specimen (SsPM-ZL), the calmodulin (CAM), RNA polymerase II subunit (RPB2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), glutamine synthetase (GS), and the internal transcribed spacer (ITS) were amplified using PMCAMF/R, PMRPB2F/R, PMGAPDH1/3R, PMGSF/R, and PM5/ITS4 primers (Bradshaw et al. 2022b), and deposited in GenBank (CAM: OR761878; RPB2: OR761881; GAPDH: OR761879; GS: OR761880; ITS: OR758452). BLAST analysis showed 99 to 100% identity with the sequences of Golovinomyces ambrosiae (FH00941234) for CAM (ON101658, 99.65%), RPB2 (ON119165, 100%), GS (ON075690, 99.78%), and ITS (ON073876, 99.47%). Phylogenetic analysis was performed in MEGAX with maximum likelihood method (Kumar et al. 2016) and clustered SsPM-ZL into the G. ambrosiae clade with a 100% bootstrap support value based on the concatenated sequences of CAM, RPB2, GAPDH, GS and ITS (Fig. S2). Combining morphological and phylogenetic analyses, SsPM-ZL was identified as Golovinomyces ambrosiae. To evaluate pathogenicity, leaves of 3 healthy potted S. subulatum plants (3 leaves per plant) were inoculated by gently pressing them with diseased leaves, while 3 non-contact plants were used as control. Plants in two groups were incubated in separate greenhouses maintained at 27±1°C, with a photoperiod of 14 hours and a r","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142591243","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Construction of an Infectious Clone of Citrus Chlorotic Dwarf-Associated Virus and Confirmation of Its Pathogenicity.","authors":"Jinfa Zhao, Song Zhang, Jiajun Wang, Binghai Lou, Yan Zhou","doi":"10.1094/PDIS-12-23-2575-RE","DOIUrl":"10.1094/PDIS-12-23-2575-RE","url":null,"abstract":"<p><p>Citrus chlorotic dwarf disease (CCDD) seriously affects the citrus industry. Citrus chlorotic dwarf-associated virus (CCDaV) is speculated to be the causal agent of CCDD. However, this speculation has not been confirmed by fulfilling Koch's postulates. In this study, an infectious clone comprising a 1.6-fold tandem CCDaV genome in the binary vector pBinPLUS was constructed and agro-inoculated into 'Eureka' lemon (<i>Citrus limon</i>) seedlings through vacuum infiltration. At 60 days postinoculation, 25% of the 'Eureka' lemon seedlings developed symptoms of crinkling and curling that were the same as those associated with the wild-type virus. Western blotting and graft transmission assays confirmed that the infectious clone systemically infected 'Eureka' lemon seedlings. In addition, CCDaV can establish infection on three more <i>Citrus</i> species and one hybrid, although at different infection rates. These findings support that CCDaV is the primary causal agent of CCDD. The infectious CCDaV clone will allow further studies on the functions of viral proteins and molecular interactions of CCDaV with its hosts.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141634211","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Xanthomonas hortorum</i> pv. <i>vitians</i> as the Causal Agent of Bacterial Leaf Spot on Lettuce in China.","authors":"Zixuan Zhao, Qiao Wang, Yanxia Shi, Xuewen Xie, A Li Chai, Baoju Li, Lei Li","doi":"10.1094/PDIS-02-24-0321-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-02-24-0321-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Lettuce (Lactuca sativa) is a leafy vegetable that belongs to the family Asteraceae. This cool-season crop grows well during Spring and Fall in China (Qi et al., 2021). In October 2023, a leaf disease with dark brown to black lesions was observed on lettuce (var. iceberg) in Yongning Town, Yanqing District, Beijing, China (40°53'N, 116°16'E). The disease incidence ranged from 10 to 40% in the surveyed greenhouse and field. Translucent and water-soaked brown spots were observed on the margins of leaf, then coalesced into large necrotic lesions surrounded by a chlorotic halo. Infected sections were soaked with 75% ethyl alcohol for 7 second, rinsed with sterile water for 15 second twice, and cut into pieces in the sterile water. The sample extracts were streaked on Nutrient agar medium. After incubation for 48 hours, 12 colonies were obtained and all the colonies were Gram-negative and aerobic with yellow, round-shape, smooth and glistening appearance. Four isolates SCZX1-SCZX4 with typical characteristics were selected for further identification tests. Pathogenicity test of SCZX1-SCZX4 was performed on the three-week-old lettuce (var. butterhead) by spraying with the bacterial suspension (108 CFU·ml-1). Inoculated lettuce were incubated at 26℃ and 70% relative humidity in the growth chamber. Another set of lettuce plants were mock inoculated with sterile distilled water. Three trials were carried out per isolate, and each treatment included fifteen lettuce plants. Symptoms appeared within 7-10 days after inoculation and are identical to those naturally infected lettuces. Negative control plants had no symptoms. The 16S rRNA region and two housekeeping genes (gyrB and atpD) of each isolate were amplified with universal primers F27/R1492 (Monciardini et al., 2006) and specific primers (Roach et al., 2018), respectively. According to BLAST analysis of each isolate (Genbank accession number PP027925, PP140779, PP140781 to PP140783, PP137422 to PP137428), BLAST searches of the obtained sequences revealed 100.0% of 16S rRNA region(1400/1400 nucleotides), 100.0% of gyrB(774/774 nucleotides), and 100.0% of atpD(768/768 nucleotides) identity and query coverage to Xhv CFBP 498 (Genbank accession number LR828257.1). Phylogenetic analysis revealed that SCZX1-SCZX4 clustered with the neopathotype strain Xhv LMG 938PT, which was isolated from a diseased L. sativa in Zimbabwe (Timilsina, S et al., 2015). Physiological and biochemical tests of SCZX1-SCZX4 were conducted by the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA), and the test results are consistent with the Xhv LMG 938PT (Morinière, L et al., 2020) and L1-L7 (Pernezny, K et al., 1995). Strains were re-isolated from re-inoculated lettuce, then re-identified as Xhv by the same method, fulfilling Koch's postulates. Bacterial leaf spot (BLS) is a worldwide-spread lettuce disease caused by numerous bacterial pathogens, including Xhv (Dia, N.C et al., 2022), Pseudomonas cichorii (Patel, N e","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142591233","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of Root-knot Nematode, <i>Meloidogyne enterolobii</i>, on <i>Luffa cylindrica</i> (L.) in Guangxi, China.","authors":"Fayu Li, Bin Shan, Xiaoxiao Zhang, Wei Zhao, Lingling Pan, Chaorong Wu, Shanshan Yang","doi":"10.1094/PDIS-09-24-1841-PDN","DOIUrl":"10.1094/PDIS-09-24-1841-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale o","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142591249","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Lelliottia amnigena</i> Causing Soft Rot on Purple Stem Mustards in China.","authors":"Junhui Li, Shiyang Qin, Yanxia Shi, Xuewen Xie, A Li Chai, Yuanhong Wang, Baoju Li, Lei Li","doi":"10.1094/PDIS-01-24-0180-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-01-24-0180-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;The purple stem mustards (Brassica rapa subsp. chinensis var. purpuraria) (Govaerts R, 2003) are widely cultivated along Yangtze River Valley in China, which is famous for its flavorful and nutritious edible stalks (Wang et al., 2022). In February 2023, a disease of soft rot was observed in multiple purple stem mustards planting fields in Wuhan city, Hubei province, China (30.41°N, 114.22°E). Disease incidence rates were almost 20 to 30% in the planting area (5 ha in size), causing severe economic loss. Infected plants displayed water-soaked symptoms at the base of the petioles, emitting a foul soft rot odor. The severely infected petioles, stems and roots exhibit pus symptoms leading to plant death. To identify the causal agent, small pieces of soft rot symptomatic tissue were cut from the margin of necrotic lesions and surface disinfected with 75% (v/v) ethanol for 30 seconds, followed by three successive rinses with sterile distilled water. The exudates from the clipped tissues were serially diluted and then incubated onto nutrient agar (NA) plates to obtain purified strains at 28°C for 48 hours (Koike et al., 2002). After incubation, 15 strains were obtained and the colonies of all strains were Gram-negative, aerobic, small, round, convex, whitish to dull white, and had smooth slimy edges. Three single bacterial strains CT020801 - CT020803, which were individually isolated from three different diseased samples, were selected as representative strains for further study. Biochemical tests using the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA) revealed that these strains were positive for methyl red, pectin, dextrin, D-Cellobiose, β-galactosidase, citrate, and maltose, but negative for indole, arginine dihydrolase, urease, ornithine decarboxylase, and gelatinase tests. The 16S ribosomal RNA gene and the three housekeeping genes, atpD, rpoB, and recN were amplified using genomic DNA of Lelliottia amnigena NCTC12124T as the template, with specially designed primers. All amplified fragments were sequenced and deposited in GenBank with accession numbers OQ954706-OQ954707, OQ954713, and OQ953873-OQ953881. BLAST alignments of the 16S rRNA, atpD, rpoB and recN sequences revealed that the sequences of Strain CT020801-03 exhibited the highest identity (100%, ≥97.97%, ≥98.85% and ≥94.52%, respectively) with L. amnigena （Figure S2）. Phylogenetic tree analysis based on multilocus sequence joint 16S rRNA - atpD - rpoB - recN revealed that CT020801 - CT020803 and L. amnigena clustered together in the same clade (Carrie et al., 2013). These results were consistent with those reported for Lelliottia amnigena (Osei et al., 2022). To confirm pathogenicity, healthy base petioles of three-week-old purple stem mustards seedlings were stab inoculated with 20 μL bacterial suspensions (approximately 108 CFU/mL) and then incubated at 28°C and 80% relative humidity in a growth chamber. A sterile liquid NB medium served as the negative control. The tes","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":null,"pages":null},"PeriodicalIF":4.4,"publicationDate":"2024-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142591166","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}