Plant disease最新文献

{"title":"First Report of Rust Caused by <i>Cerotelium fici</i> on <i>Ficus carica</i> L. in Korea.","authors":"Min Sun Ha, Hobhin Lee, Hyunjoo Ryu, Hyeon-Yeong Ju, Hyo-Won Choi, Hyo-Suk Kim, Sung Kee Hong","doi":"10.1094/PDIS-10-24-2084-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-10-24-2084-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Fig (Ficus carica L.) belonging to the Moraceae family is cultivated worldwide, with its primary production areas located in the Mediterranean region (Tous and Fergusen 1996). Yeongam-gun is a significant region for fig cultivation in Korea, accounting for 42% of the country's total fig cultivation area with approximately 1,400 fields (453ha, production yield 6000 tons). In July to November 2023, we observed severe rust disease in four fig orchards in Yeongam-gun (34°42'52.2\"N, 126°31'32.16\"E). The disease had affected 70% of the fig cultivation area (cv. Masui Dauphine). The area of each field is approximately 0.33~0.66ha, and 5 samples were collected from each field. Pustules of the pathogen were found in all samples. The diseased plants were deposited in the herbarium of the National Institute of Agricultural Sciences, Wanju, Korea (Specimen No. Cero_001). The initial symptoms were observed as chlorotic spots on the adaxial surface of the leaves, which developed into necrotic areas surrounded by chlorotic halos. Over time, dark brown spots were observed on the adaxial surface of the leaves, and abundant reddish-brown pustules were visible on the abaxial surface. Almost all leaves with these symptoms fell prematurely. Microscopic observation revealed that the urediniospores (n&gt;50) were ellipsoidal, globose, obovoidal, or angular in shape, yellowish to faintly orange in color, sized 19.5-39.9 × 10.1-27.5 μm and had a wall thickness of 0.6-1.5 μm (average 1 μm). Telia were not observed. These morphological characteristics were comparable with that of Cerotelium fici (Gardner, 1997; Latinovic et al., 2015). For molecular analysis, genomic DNA was extracted from 3 to 5 samples, and the internal transcribed spacer region 2 (ITS2) and the large subunit (LSU) were amplified and sequenced using primer set: Rust2inv (Aime, 2006) and LR6 (Vilgalys and Hester, 1990). Furthermore, approximately 660 bp of the cytochrome c oxidase subunit III (COX3) gene was amplified and sequenced with CO3_F1 and CO3_R1 primers (Vialle et al., 2009). The obtained sequences were deposited in NCBI GenBank (GenBank accession no. PP491072 to PP491074 and PP491079 to PP491081). Phylogenetic tree analysis using the maximum likelihood method identified the isolate as Cerotelium fici. Pathogenicity test was conducted either by placing or by rubbing symptomatic leaf pieces on healthy leaves (5 leaves/plant) of three-year-olds fig plants (cv. Masui Dauphine) in a greenhouse in Wanju-gun, Jeonbuk special self-governing province. Healthy and symptom free leaf pieces were used for control. Two plants per treatment were used and the experiment repeated twice. The typical symptoms of fig rust disease were observed two weeks after inoculation in both methods. Control leaves were symptomless. C. fici was successfully reidentified from symptomatic tissues of inoculated leaves, fulfilling Koch's postulates and confirmed as a causal agent of fig rust. Fig rust caused by C. fici has been ","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-18","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142855000","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of Powdery Mildew Caused by <i>Erysiphe trifoliorum</i> on <i>Aeschynomene indica</i> in China.","authors":"Xiaoli Li, Mengdan Li, Lufan Zhang, Xue Xin, Yi Zhang, Kedong Xu, Deshui Yu","doi":"10.1094/PDIS-12-24-2529-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-12-24-2529-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Aeschynomene indica is a semiaquatic legume that can be used as field green manure, forage grass, and medicinal plant (Zhang et al., 2019). It is also an \"amphibious\" plant commonly used as a wetland park green plant. In October 2020, typical powdery mildew symptoms were found on A. indica plants in Fanglan Lake Wetland Park, Jiujiang City, Jiangxi Province, China. More than 90% of A. indica plants were infected, and powdery mildew covered both sides of infected leaves, as well as stems and pods, forming circular to irregular patches. The infected leaves were collected to identify the pathogen, and microscopic examination revealed that there were abundant conidia and hyphae on the surface of the leaves. The conidia were solitary, elliptical to cylindrical, 23.23-38.03 μm in length and 9.14-17.56 μm in width (n = 100). The conidiophores were straight, cylindrical, unbranched, and ranged from 43.80 to 76.16 μm in length (n = 100). The foot cells were cylindrical or, rarely, somewhat curved at the base, 23.20-47.07 × 4.23-8.87μm (n = 100) and were followed by 1-2 shorter cells. Appressoria and chasmothecia were not observed on the collected samples. Based on these morphological characteristics, the powdery mildew fungus was tentatively identified as Erysiphe trifoliorum (Lee and Thuong, 2015). To further confirm this identification, the ribosomal DNA internal transcribed spacer (ITS) region and the partial sequence of the 28S large subunit (LSU) were amplified using primer pairs ITS1/ITS4 (White et al., 1990) and NL1/NLP2 (Mori et al., 2000), respectively. The obtained 662-bp ITS sequence (GenBank accession no. OK021589) was 99.55% identical to the ITS sequences of E. trifoliorum on Medicago littoralis in Azerbaijan (LC270860). The obtained 656-bp LSU sequence (GenBank accession no. PQ475931) was 99.69% identical to the ITS sequences of E. trifoliorum on Mimosa pudica in China (PQ184869). Additionally, a phylogenetic tree analysis was conducted based on the combined ITS and LSU sequences, which indicated that the isolate was grouped in the same clade as E. trifoliorum. Therefore, this fungus was identified as E. trifoliorum based on the morphological and molecular characteristics. Pathogenicity tests were performed by gently pressing infected leaves onto the young leaves of six healthy A. indica plants, and non-inoculated plants were used as controls. All plants were maintained in a greenhouse (25 ± 2 °C, 80% relative humidity, and a 16-hour photoperiod). After 14 days, typical powdery mildew features were observed on the inoculated plants, whereas no such features appeared on the control plants. The fungus on the inoculated leaves was morphologically and molecularly identical to that found on naturally infected plants collected from the Jiangxi Province. Powdery mildew caused by E. trifoliorum has been reported to affect some leguminous plants, including Indigofera amblyantha, Trifolium hybridum, Trifolium repens, and Melilotus indicus (Cho e","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142838558","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Occurrence of Snake River alfalfa virus in alfalfa (<i>Medicago sativa</i>) in Oregon and in Northern California.","authors":"Gardenia Orellana, Casey H Messman, Edison Reyes-Proaño, Amber Moore, Erik J Wenninger, Alexander V Karasev","doi":"10.1094/PDIS-10-24-2134-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-10-24-2134-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Alfalfa (Medicago sativa L.) is a commonly grown forage crop in Oregon and California harvested on 350,000 and 480,000 acres, respectively, in 2023 (USDA-NASS 2023). Forage alfalfa is grown as a perennial crop for about four years in the same field and each season, the crop is cut 3-4 times for hay production. Consequently, each plant is exposed to a variety of biotic stresses including virus infections, with pathogens accumulating in the crop over years. Alfalfa was recognized in the past as a reservoir of legume viruses posing threats to peas and other legumes in the Pacific Northwest (PNW) of the United States (Hampton and Weber 1983; Kaiser et al. 1993). The most common viruses found in alfalfa in PNW are aphid-transmitted alfalfa mosaic virus (AMV), bean leafroll virus (BLRV), and pea streak virus (PeSV) (Hampton and Weber 1983; Kaiser et al. 1993; Larsen 2015; Dahan et al. 2022; Postnikova et al. 2023). Recently, a new virus, Snake River alfalfa virus (SRAV) was described from alfalfa in Idaho (Dahan et al. 2022), in Washington (Postnikova et al. 2023), and in Europe (Meseguer et al. 2024). Within PNW, surveys of alfalfa viruses in Oregon were not conducted for the past 30 years, and to fill in this knowledge gap on alfalfa viruses in the State of Oregon, a survey was initiated in the summer 2023. One-hundred thirty-nine leaf samples were collected from 13 alfalfa fields across Oregon, from four fields in Southern Idaho, and from four fields in Northern California between July 15 to September 5, 2023. Five to seven individual samples per field, exhibiting various virus-like symptoms, such as mosaic, chlorotic spots, leaf deformations, and yellowing, were collected randomly, placed in paper bags and shipped to the laboratory at the University of Idaho. Total nucleic acids were extracted from leaf tissue within 3-5 days after the field collections using the Dellaporta methodology (Dellaporta et al. 1983). Reverse transcription (RT) PCR was conducted according to the previously described protocol with specific primers for AMV, BLRV, and SRAV described by Dahan et al. (2022). For PeSV detection, two specific primers, PeSV_2F: TCACTGGATCATGGCYTTTG and PeSV_2R: AACCTTGAATCCTGACGCAA were designed and used in RT-PCR. In virus-positive samples, PCR fragments were treated with Exosap-It (Thermo Fisher Scientific, Waltham, MA), submitted for Sanger sequencing to Elim Biopharmaceuticals, Inc. (Hayward, CA), and confirmed to be virus-specific. The partial sequences of the alfalfa viruses found in Oregon, Idaho, and California were deposited in GenBank under the accession numbers PQ451070 to PQ451075 (PeSV), PQ451076 to PQ451087 (BLRV), PQ451088 to PQ451108 (AMV), and PQ467775 to PQ467806 (SRAV). Out of 139 samples tested, 61 were AMV-positive, 51 were BLRV-positive, 81 were SRAV-positive, and 6 were PeSV-positive. In-field prevalence varied between the four viruses, ranging for PeSV from 0% (1 field in CA, 4 fields in ID, and 8 fields in OR) to 43","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142838562","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of <i>Diaporthe ueckeri</i> and <i>Diaporthe longicolla</i> as the causal agent of pod and grain rot of soybean in Brazil.","authors":"Cosma Raissa Bezerra do Nascimento, Rafael Souza Anjos, Raphael Rosa Barboza, Hiago Antonio Oliveira da Silva, Iris Carolina Henrique de Lima Leite, Daniel Yuri Xavier Sousa, Miller da Silva Lehner, Juliano Martins Diniz, Eduardo S G Mizubuti","doi":"10.1094/PDIS-10-24-2255-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-10-24-2255-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Epidemics of pod and grain rot (PGR) of soybean (Glycine max (L.) Merr.), popularly referred to as \"pod anomaly\", have economically impacted Brazilian farmers, especially in Mato Grosso (MT), Brazil's largest producer state, where incidence varies from 10 to 40%. Although Diaporthe ueckeri was reported causing soybean seed decay in Santa Catarina state (SC), a disease similar to PGR, no pod inoculation was attempted and no rot symptoms reproduced. Here, we report Diaporthe ueckeri and D. longicolla as the causal agents of PGR. A total of 118 isolates were obtained from symptomatic grains, pods, and stems, across five Brazilian states other than SC: Mato Grosso (n = 62), Paraná (n = 20), Minas Gerais (n = 19), Goiás (n = 14), and Rio Grande do Sul (n = 3) during the 2022/23 and 2023/24 seasons. Infected grains and pods usually had necrotic lesions and were poorly developed. Symptomatic plant parts (stems, pods, and grains) were collected and maintained under high relative humidity conditions in the laboratory. Pycnidia or cirri were transferred from infected tissues onto PDA at 25 °C and monoconidial isolates were obtained, thereafter. Colonies were light gray with a dense and fluffy appearance. Pycnidia were erumpent, with elongated necks and cirri were observed. Alpha conidia were aseptate, hyaline, and biguttulate, measuring 6.6 to 8.6 μm length × 1.6 to 2.2 μm width, similar to those of Diaporthe spp. (Udayanga et al. 2015). Isolates were considered pathogenic when depressed necrotic lesions with or without pycnidia were formed after inoculation of 'Williams 82' at the V2 growth stage by the toothpick method which consisted of the insertion of a toothpick colonized by the fungus 1 cm below the cotyledonary node. Insertion of a non-infested, sterilized toothpick, was used as control. Partial sequences of the internal transcribed spacer (ITS) (White et al. 1990), translation elongation factor 1-α (TEF) (Carbone and Kohn 1999), calmodulin (CAL) (Carbone and Kohn 1999), and beta-tubulin (TUB) (Glass and Donaldson 1995) were amplified. GenBank accessions codes for UFVDUS-20 and UFVDLS-67 are ITS: PQ331841 and PQ331842; TEF: PQ37542 and PQ375427; CAL: PQ375426 and PQ375428; TUB: PQ375429 and PQ375430, respectively. Sequences of TEF of UFVDUS-20 and UFVDLS-67 were 100% similar to D. ueckeri strain 17-DIA-079 (MK941298.1) and D. longicolla D15.1 (MN584786.1), respectively. Bayesian inferences with the concatenated dataset grouped UFVDUS-20 and UFVDLS-67 with the reference strains of D. ueckeri or D. longicolla, respectively. Isolates UFVDUS-20 (D. ueckeri from MT) and UFVDLS-67 (D. longicolla from Goiás) were used for inoculation of soybean plants and detached pods with a 1×106 conidia/mL suspension. Sterile distilled water with Tween was used as control. Five pots (replicates) each with two 'L93-3312' plants at the V4 and R5 stages were used for inoculation until the runoff point and incubated at 28 °C, &gt; 95% RH, and 12h-photoperiod. Plants wer","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-14","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142824425","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"<i>Golovinomyces macrocarpus</i> Causing Powdery Mildew on <i>Achillea millefolium</i> in Korea.","authors":"Jun Hyuk Park, Joon-Ho Choi, Young-Joon Choi, Hyeon-Dong Shin","doi":"10.1094/PDIS-12-24-2581-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-12-24-2581-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Achillea millefolium L. (Asteraceae), commonly known as yarrow or common yarrow, is native to temperate regions of the Northern Hemisphere in Asia, Europe, and North America (https://www.missouribotanicalgarden.org/). The plant is not indigenous to Korea, and many commercial varieties have been introduced and are grown in gardens for ornamental purposes. Since 2014, A. millefolium has been found infested with a powdery mildew at different sites in Korea, with a disease incidence of 30-50% among the surveyed plants. Five representative voucher specimens were deposited in the Korea University herbarium (KUS-F27956, F28670, F28776, F33575, and F33963). Symptoms first appeared as circular to irregular white patches, which subsequently coalesced to develop into abundant hyphal growth on both sides of the leaves. Hyphal appressoria were nipple-shaped. Conidiophores were cylindrical, 110 to 186 × 10 to 12 µm, and produced 2 to 5 immature conidia in chains with a sinuate outline. Foot-cells of conidiophores were straight, cylindrical, and 44 to 72 μm long. Conidia were ellipsoid to doliiform-limoniform, 30 to 38 × 16 to 22 μm (l/w 1.5 to 2.0), and devoid of distinct fibrosin bodies. Germ tubes were produced at the perihilar position of the conidia. Chasmothecia were not observed until the natural senescence of the leaves in early winter. These morphological characteristics are consistent with those of Golovinomyces macrocarpus (Speer) U. Braun (Braun and Cook 2012). Sequences of the internal transcribed spacer (ITS) and large subunit (LSU) rDNA regions of three herbarium specimens (KUS-F27956, F28670, and F28776) were determined using primer pairs PM10/ITS4 and PM3/TW14, respectively (Bradshaw and Tobin 2020). A comparison of the resulting sequences using the BLASTn algorithm showed 100% identity with reference sequences of G. macrocarpus (ITS: AB077685 and LSU: AB769429) in the NCBI GenBank database. Obtained sequences were deposited in GenBank (Accession Nos: PQ682288-90 for ITS and PQ682291-3 for LSU). A maximum likelihood tree was constructed based on the ITS+LSU dataset of 20 sequences. Our sequences were clustered with sequences of G. macrocarpus and supported with a 96% BS value. A pathogenicity test was performed twice by gently dusting the conidia of the sample KUS-F33963 onto the leaves of five healthy potted plants. Five non-inoculated plants served as controls. Powdery mildew colonies developed on all inoculated plants after a week, whereas the control plants remained symptomless. The fungus on the inoculated leaves was morphologically identical to that observed on the originally diseased leaves, fulfilling Koch's postulates. Previously, Erysiphe cichoracearum (syn. G. cichoracearum) was recorded on this plant in Europe, North America, and Japan (Farr and Rossman 2024; Nomura 1997). Since G. cichoracearum has been divided into several distinct species (Qiu et al. 2020; Takamatsu et al. 2013), the current taxonomic position of Golovinomy","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-14","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142824424","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"<i>Erysiphe russellii</i> Causing Powdery Mildew on <i>Oxalis corniculata</i> L. in Central China.","authors":"Juncong Liu, Yuge He, Zongbo Qiu, Shah Fahad, Sujing Zhao, Mo 墨 Zhu 朱","doi":"10.1094/PDIS-10-24-2249-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-10-24-2249-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Oxalis corniculata L. (Creeping woodsorrel) is a perennial plant of the genus Oxalis in Oxalidaceae family, which has the high ornamental and medicinal value. Extracts of creeping woodsorrel are used as antioxidants and cholinesterase inhibitors and for anti-inflammatory, antiseptic, analgesic, antirheumatic ache, and antimicrobial purposes (Leporatti et al. 2003). In June 2024, powdery mildew was found on the leaves of Creeping woodsorrel in Xinxiang City, Henan Province, China (113.925°E, 35.294°N). About 100 plants were examined and 80 % were infected with disease symptoms, i.e. curling and senescence. The white masses were on the both sides of plant leaves covering up to 90% of the leaves area. The slightly or straight curved conidiophores (n = 50) were 68 to 99× 6 to 12 μm in size and consisted of foot cells, shorter cells and singly conidia. The ellipsoidal to oval conidia (n =50), were 26 to 10 ×11 to 5 μm in size and had a length/width ratio of 1.6 to 2.2. These morphological characteristics were similar to the previously reported Creeping woodsorrel powdery mildew fungus, Erysiphe russellii (Thuong et al. 2017; Takamatsu et al. 2015). Following previously described methods (White et al. 1990; Bradshaw et al. 2022; Zhu et al. 2022), the ITS (ribosomal transcribed spacer), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), RPB2 (RNA polymerase II), GS (glutamine synthetase) and CAM (calmodulin) gene regions of three isolates were amplified with specific primers ITS1/ITS4 (ITS1 5'-TCCGTAGGTGAACCTGCGG-3'; ITS4 5'-TCCTCCGCTTATTGATATGC-3'), PMGAPDH1/PMGAPDH3R (PMGAPDH1 5'-GGAATGGCTATGCGTGTACC-3'; PMGAPDH3R 5'-CCCCATTCGTTGTCGTACCATG-3'), CAM1/CAM4R (CAM1 5'-CTTTGCATCATGAGTTGGAC-3'; CAM4R 5'-GGCTCGAAAAATGAAAGATACCG-3'), Rpb2_4/Rpb2_6R (Rpb2_4 5'-GCAAGCTCAACTGCTGGTG-3'; Rpb2_6R 5'-TCCAGCGATGTGCTGTTGG-3'), GSPM2/GSPM3R (GSPM2 5'-CCAATCAGTTACTGTTTGTTCCC-3'; GSPM3R 5'-GGACTTCCTGATATTATGCC3'). Sanger sequencing results showed that each sequence of the three isolates were the same. Then sequences of one isolate were uploaded in GenBank (Accession No. PQ044579, PQ149219, PQ149220, PQ149221and PQ149222, respectively). The sequences were 100% identical to those of a previously reported E russellii on O. corniculata (Thuong et al. 2017; Takamatsu et al. 2015). The pathogen and the previously reported E russellii are clustered in the same branch in the phylogenetic tree (Thuong et al. 2017; Takamatsu et al. 2015). The pathogenicity was tested according to the method previously described (Zhu et al. 2021). By blowing conidia on infected leaves with pressurized air, the fungus was inoculated onto the leaves of three healthy plants (three-month-old), with three uninoculated plants (three-month-old) treated as controls. The infected plants and the control plants were placed in the culture room with the temperature 23 °C, humidity 50% and light/Dark 16/8 h, respectively. 10-12 days post inoculation, the leaves of the inoculated plants showed signs and symp","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-14","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142824423","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of <i>Phytopythium helicoides</i> causing root and crown rot on Rhododendron in Ohio and the United States.","authors":"Rachel Capouya, Jonathan Michael Jacobs, Francesca Peduto Hand","doi":"10.1094/PDIS-10-24-2205-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-10-24-2205-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;&lt;i&gt;Rhododendron&lt;/i&gt; is a diverse genus of evergreen and deciduous species grown in gardens worldwide for their attractive flowers and foliage. In summer 2023, nine of 12 potted &lt;i&gt;Rhododendron&lt;/i&gt; 'Nova Zembla' plants purchased from a wholesale nursery in Ohio exhibited wilting, leaf and stem discoloration, and severely darkened and softened roots, which eventually progressed into dieback and plant death. Roots tested positive with a Phytophthora Immunostrip® (Agdia, Inc.), a common serological test for oomycete root rots. Roots were surface disinfested by soaking in 10% bleach for 30 s, rinsed three rinses in sterile water, then sectioned into small pieces and plated on oomycete-selective PARP-CMA medium (Ivors, 2015). Pure cultures were obtained by transferring hyphal tips onto potato dextrose agar (PDA) and incubating at 23 ± 2 °C under fluorescent light (12 h) for one week. Colonies on PDA displayed radiate to petaloid radial growth with minimal aerial aseptate mycelia. Sporangia production was induced by flooding mycelial plugs with sterile 10% V8 broth and incubating in the dark for 48 h at 23 ± 2 °C. The resulting mycelial mat was rinsed three times with sterile water then mounted on glass slides. Sporangia were terminal, globose and rarely obovoid, papillate or non-papillate, and measured 22.24-46.38 µm in length and 19.80-33.70 µm in width (n=35). Oospores were not observed in culture after 1 week of incubation at room temperature. DNA was extracted using the QIAGEN DNEasy Plant Mini Kit from mycelial mats grown in potato dextrose broth for 7 days at 26°C with 70 rpm shaking followed by straining. PCR and bidirectional sequencing were conducted with primers OomCOILevup/FM85mod (mtDNA COX1 region; Robideau 2011), and NL1/NL4 (rDNA D1-D2 large subunit; O'Donnell 1993). NCBI BLAST searches of the LSU and COX1 consensus sequences had 100% (637/637 bp; PQ381277) and 98.33% (708/720 bp; PQ383368) match, respectively, to the type strain of &lt;i&gt;Phytopythium helicoides&lt;/i&gt; PF-he2 (OM337587.1, GCA_024867545.1). Five of the nine plants yielded isolates identified as &lt;i&gt;P. helicoides&lt;/i&gt; by sequencing. Isolate FPH2023-33 was selected for in-depth characterization. Pathogenicity tests were conducted once using young (&lt;6\" height and diameter) Rhododendron 'PJM Elite Star' (n=6), and once using 'Cherries and Merlot' (n=6) plants. Plants were inoculated by placing five, 5-mm agar plugs taken from 3-day old V8 agar cultures or sterile V8 agar plates (control) into the root area of each plant. Plants were maintained in flood trays under saturated soil conditions for 30 days in the greenhouse at an average of 24°C and 70% RH. Uninoculated plants were kept in separate trays to prevent cross-contamination. At 30 DPI, 75% of inoculated 'PJM Elite Star' plants showed severe leaf curl and wilting, and 100% had darkened and weakened root systems, while 50% of inoculated 'Cherries & Merlot' plants showed stunting, and 75% showed mild discoloration of the roo","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-14","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142824426","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of saffron-associated mastrevirus 1 from saffron in Iran.","authors":"Seyyedeh Atefeh Hosseini, Charlotte Julian, Serge Galzi, Denis Filloux, Philippe Roumagnac","doi":"10.1094/PDIS-11-24-2462-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-11-24-2462-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;In spring 2022, 40 leaf samples of saffron plants harboring a wide variety of symptoms, including curling, yellowing, mosaic, dwarfing and leaf malformation were collected from three Khorasan provinces in Iran. These samples were processed using the virion-associated nucleic acid-based metagenomics approach (Moubset et al., 2022). Noteworthy, 147 contigs with a size &gt;500 bp distributed among 35 samples with multiple symptomatic patterns (curling, yellowing, mosaic, dwarfing and leaf malformation) shared &gt;90% nucleotide identity with saffron-associated mastrevirus 1 (SaM1) (Martínez-Fajardo et al., 2024). This virus has recently been detected from transcriptomic datasets from saffron (Crocus sativus L.) collected in India. SaM1 was proposed to belong to a new species of the Mastrevirus genus (Geminiviridae family) and was tentatively named Saffron-associated mastrevirus 1 (Martínez-Fajardo et al., 2024). In addition, contigs assigned to saffron potyviruses, including saffron latent virus, turnip mosaic virus and bean yellow mosaic virus were assembled from the 40 saffron samples pinpointing that no conclusion could be made on the causal virus of observed symptoms. Total DNAs of the 40 saffron samples were further extracted using the DNeasy Plant Mini Kit (Qiagen) and were tested for the presence of SaM1 using a primer pair amplifying a 327 bp long fragment located in the coat protein of SaM1 (CSAV_2F 5'-TTTAAGTCAGGGTCTGGAGATG-3'and CSAV_3R 5'-GGCATACTGTAACCTCGTCTTC). Amplification conditions were: an initial denaturation at 95°C for 10 min, 30 cycles at 95°C for 30 sec, 55°C for 30 sec, 72°C for 45 sec, and a final extension step at 72°C for 10 min. This PCR test confirmed that 28/40 samples tested positive for SaM1. Total DNAs from one sample (#69-32) testing positive for SaM1 was further amplified using Phi29 DNA polymerase (TempliPhi, GE Healthcare) by rolling circle amplification (RCA) as previously described (Shepherd et al., 2008). RCA products were used as a template for PCR amplification of the complete genome of SaM1 using abutting primers (CSAV_PST1F 5'-CTGCAGTTGCGGTAAGTCTATGTTGGCTG-3' and CSAV_PST1R 5'- CTGCAGAGACAACGATTCCCAAAATTACTTTGTTCC-3'). Amplification conditions were: an initial denaturation at 95°C for 10 min, 30 cycles at 95°C for 30 sec, 55°C for 1 min, 72°C for 2 min and 30 sec, and a final extension step at 72°C for 10 min. Amplification products of approximately 2.7 Kbp were gel purified, ligated to pGEM-T Easy (Promega) and sequenced by standard Sanger sequencing using a primer walking approach (Azenta, Germany). The arrangement of open reading frames within the 2,724 nt circular DNA of the CSAV_A9PstI clone (accession number PQ392009) is similar to those reported for mastreviruses, including the coat protein (CP), the movement protein (MP), the replication-associated protein (Rep) and the RepA protein. In addition, CSAV_A9PstI sequence shares 95.3% genome-wide identity with SaM1 consensus sequence assembled from tra","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-14","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142824427","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Leaf spot of <i>Acorus calamus</i> var. <i>angustatus</i> Caused by <i>Alternaria alternata</i> in Anhui Province, China.","authors":"Ping Li, Dong Liu, Bixia Yu, Xiaohe Song","doi":"10.1094/PDIS-05-24-0947-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-05-24-0947-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;&lt;i&gt;Acorus calamus&lt;/i&gt; var. &lt;i&gt;angustatus&lt;/i&gt; Besser, a perennial herb of the Araceae family, was first reported in the Shen Nong's Herbal Classic and is widely distributed in southern China (Li 1979). It is important in traditional Chinese medicine for treating heart, stomach, and brain ailments (Lam et al. 2016). In March 2024, leaf spots were found on its leaves in a traditional Chinese medicine planting base in Yuexi County (30°91'56″ N, 116°19'24″ E), Anhui Province, with an incidence of about 35%. The symptoms began as small, light brown lesions that expanded, resulting in necrotic lesions ranging from 1 to 8 mm in diameter with brown halos. 3 × 3 mm sections, including both symptomatic and asymptomatic tissues, were cut from six infected plants. They were disinfected in 75% ethanol for 30 s, washed three times with sterile distilled water, transferred to Petri dishes containing potato dextrose agar (PDA) and incubated at 25 °C in the dark. Purified fungal isolates were obtained by the single-spore isolation method. The colonies on PDA initially appeared white, gradually became olive-green with 1 to 3 mm white margins and abundant aerial hyphae, while the reverse was greyish green to black. The conidia were light brown, ellipsoidal, obclavate, and 10.0 to 49.5 µm × 4.5 to 16.4 µm (mean 23.9 × 10.2 µm, n=50) in size, with 0 to 6 transverse septa and 0 to 6 longitudinal or oblique septa (n=50). Conidiophores were thick, dark brown, single-celled, with multiple conidial scars, measuring 12.8 to 146.8 × 2.9 to 6.1 (mean 50.6 × 4.2) µm (n=50). Based on above observations, the pathogen were identified as &lt;i&gt;Alternaria&lt;/i&gt; spp. (Simmons 2007). Three representative isolates, SCP-1, SCP-2, and SCP-3 were selected for molecular identification. The Internal transcribed spacer (ITS), Alternaria major allergen (&lt;i&gt;Alt a 1&lt;/i&gt;), and translation elongation factor 1-alpha (&lt;i&gt;TEF1&lt;/i&gt;) genes were amplified with the primers ITS1/ITS4 (White et al. 1990), Alt-for/Alt-rev (Woudenberg et al. 2015) and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. The sequences of the three isolates were consistent, and the sequences of isolate SCP-1 were submitted to NCBI GenBank (ITS, PP723104; &lt;i&gt;Alt a1&lt;/i&gt;, PP708704; &lt;i&gt;TEF1&lt;/i&gt;, PP708703). The ITS region of isolate SCP-1 was 100% similar to &lt;i&gt;A. alternata&lt;/i&gt; TCS3002 (MN394880, Wang et al. 2023), the &lt;i&gt;Alt a 1&lt;/i&gt; gene was 100% similar to &lt;i&gt;A. alternata&lt;/i&gt; CBS 620.83 (KP123868), and the &lt;i&gt;TEF1&lt;/i&gt; gene was 100% similar to &lt;i&gt;A. alternata&lt;/i&gt; CBS 916.96 ex-type (KC584634). A phylogenetic tree based on sequences of ITS, &lt;i&gt;Alt a 1&lt;/i&gt; and &lt;i&gt;TEF1&lt;/i&gt; genes was constructed using the neighbor-joining method in MEGA 7 software, confirming the fungus as &lt;i&gt;A. alternata&lt;/i&gt;. Three healthy plants of &lt;i&gt;A. calamus&lt;/i&gt; var. &lt;i&gt;angustatus&lt;/i&gt; were spayed with conidial suspension (1 × 10&lt;sup&gt;7&lt;/sup&gt; conidia/ml) of isolate SCP-1. Three additional plants sprayed only with sterile distilled water were controls. All p","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-13","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142818946","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Pectobacterium brasiliense</i> Causing Soft Rot of Melon in China.","authors":"Wenjie Dong, Quanyu Zang, Erlei Ma, Weihong Ding, Yuhong Wang, Fangmin Hao","doi":"10.1094/PDIS-08-24-1768-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-08-24-1768-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;In May of 2024, a stem soft rot disease in melon (Cucumis melo L.) was observed in Ningbo (29.52°N, 121.31°E), Zhejiang Province of China. The disease incidence was approximately 30% in two greenhouses (ca. 8 m × 50 m each). The soft rot yellowish-brown lesions developed on infected stems, soft rotted with a bad foul odor. To identify the pathogen, the diseased stems from four plants were surface sterilized by soaking in 75 % ethanol for 30 s, followed by rinsing three times in sterile distilled water (SDW). The stems were cut in 5 mm fragments and let stand in SDW. After 5 minutes 100 µL of the water was spread on nutrient agar (NA). After incubation at 28°C for 24 h, seven bacterial colonies were selected and individually transferred to new NA plates. Three strains (PB052001, PB052002 and PB052003) were randomly selected as representatives for further study. They were streak-inoculated on NA for formation of single colonies (28°C, 3 d). The colonies were white and round in shape with neat, slightly raised margin. Total genomic DNA was extracted from the three bacterial strains using EasyPure Bacterial Genomic DNA Kit (TransGen, Beijing). It was used as template for PCR amplification of 16S rDNA as well as the five house-keeping genes (pgi, proA, mtlD, mdh and icdA) using specific primers (Lane 1991; Ma et al. 2007; Waleron et al. 2008). The resulting DNA fragments were cloned and sequenced. The three bacterial strains had 100% identical DNA sequences at each of the six loci, therefore, only the DNA sequences from strain PB052001 were deposited in GenBank. Sequence analysis showed that the 16S rDNA in PB052001 (GenBank Acc No. PQ146559) was 99.67% (1501/1506 nt) and 99.60% (1500/1506 nt) identical to those in Pectobacterium brasiliense SR10 (CP084655) and 21PCA AGRO2 (CP113504), respectively. A multilocus phylogenetic analysis was done based on pgi, proA, mtlD, mdh and icdA from PB052001 (GenBank Acc Nos. PQ145967, PQ145968, PQ145969, PQ145970 and PQ145971, respectively). The result showed that the three strains clustered together with P. brasiliense. To confirm pathogenicity, a bacterial suspension of PB052001 (108 cfu/mL) was injected into stems (10 per treatment) of melon seedlings (cultivar Fengsu No.10) at 1 cm below the cotyledons, 10 µL for each plant. Ten seedlings was injected SDW as negative control. The treated seedlings were grown at 28°C under 80% relative humidity. After 24 h, while the control plants remained healthy, the plants inoculated with the bacteria showed soft rot symptoms. Additionally, the bacterial suspension was sprayed on melon leaves (10 per treatment), and SDW was sprayed on melon leaves as a control. The plants were incubated under the same conditions described above. After 3 d, the control leaves remained healthy, the leaves treated with the bacteria exhibited soft-rot symptoms. Bacteria were re-isolated from the diseased tissues, and morphological and molecular identification showed that it was identical t","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2024-12-13","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142818945","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}