Plant disease最新文献

{"title":"Patterns of damage functions: Crop yield loss according to injury from disease and pest at varying attainable yields.","authors":"Laetitia Willocquet, Serge Savary","doi":"10.1094/PDIS-03-25-0609-RE","DOIUrl":"https://doi.org/10.1094/PDIS-03-25-0609-RE","url":null,"abstract":"<p><p>Damage functions, i.e., the relationships between crop yield loss (or relative yield loss) and disease injury provide pivotal quantitative knowledge to inform tactical and strategic decisions for disease management. Damage functions depend on the level of the attainable yield (Ya), i.e., on crop yield in absence of injury. Although well-known, this effect has been poorly documented despite its clear relevance to disease management. Here, the effects of variable Ya on the shapes of damage functions were therefore analysed using the available literature. Damage functions expressed as relative yield loss were analysed on seven major crops for 17 plant pathogens or pests. Two main groups of injuries are distinguished. First, injuries that are associated with several damage mechanisms involving compensation processes, leading to decreased yield-reducing effects of injury as Ya increases. These damage mechanisms are: light stealing, leaf senescence acceleration, reduction of radiation use efficiency, and thinning of crop stand. Second, for injuries that are associated with assimilate diversion, the yield-reducing effect increases as Ya increases. The relationships between actual yield and injury levels at varying Ya were then examined, allowing to (1) derive disease management strategies according to Ya; (2) illustrate how damage functions can be used to establish injury thresholds according to the levels of Ya; and (3) highlight the risk of wrong decisions in disease management, if these decisions are only based on a single damage threshold value determined for a single Ya. The paucity of available literature on the topic calls for further research to quantify damage mechanisms and damage functions at varying Ya on a broader diversity of crop diseases and pests.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144275552","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"<i>Colletotrichum</i> Causing Anthracnose of Citrus in Thailand Including <i>C. kokhaense</i> sp. nov. and a New Host Record for <i>C. gigasporum</i>.","authors":"Weixia Wang, Paul William James Taylor, Surachat Chomram, Niloofar Vaghefi, Peter Kevin Ades, Jacqueline Edwards, Pedro W Crous, Boonsom Bussaban","doi":"10.1094/PDIS-02-25-0432-RE","DOIUrl":"https://doi.org/10.1094/PDIS-02-25-0432-RE","url":null,"abstract":"<p><p><i>Colletotrichum</i> species are important fungal plant pathogens associated with citrus pre- or post-harvest disease globally. Seventy-three <i>Colletotrichum</i> isolates were collected from diseased leaves, fruits and twigs of lime, tangerine and pomelo in the provinces of Chiang Mai, Nakhon Pathom and Lampang in Thailand. <i>Colletotrichum siamense</i>, <i>C. gloeosporioides</i>, <i>C. fructicola</i>, <i>C. gigasporum</i>, <i>C. kokhaense</i> sp. nov., <i>C. plurivorum</i> and <i>C. tropicicola</i> were identified using morphological characters and multi-gene phylogenetic analysis (combinations of ITS, gapdh, ApMat, gs, tub2, act and his3 depending on the species complex). <i>Colletotrichum siamense</i> was the most prevalent species in Thailand, <i>C. gigasporum</i> was reported for the first time as a pathogen of citrus globally and the new species <i>C. kokhaense</i> in the magnum species complex was described. Pathogenicity tests confirmed that <i>C. siamense</i>, <i>C. gloeosporioides</i>, <i>C. gigasporum</i>, <i>C. kokhaense</i> sp. nov. and <i>C. plurivorum</i> were pathogenic to citrus fruits, seedlings and in planta shoots, with <i>C. gigasporum</i> being the most aggressive species. The non-wound inoculation technique provided good discrimination between high and low aggressive species compared to wound inoculation where most species appeared to be very aggressive. Knowledge of <i>Colletotrichum</i> species causing citrus disease and their pathogenic ability will assist the development of effective disease management strategies.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144275547","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"<i>Fusarium fabacearum</i> causing dwarfism and chlorosis of lima bean plants in Brazil.","authors":"Edcarlos Camilo da Silva, Hilderlande Florêncio da Silva, Otilia Ricardo de Farias, José Manoel Ferreira de Lima Cruz, Monica Danielly de Mello Oliveira, Mirelly Miguel Porcino, Maria Silvana Nunes, Severino de Carvalho Neto, Sami Jorge Michereff, Kamila C Correia, Luciana Cordeiro do Nascimento","doi":"10.1094/PDIS-03-25-0673-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-03-25-0673-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Lima bean (Phaseolus lunatus L.) is among the main crops grown in the Northeast of Brazil. In October 2023, we observed various lima bean plants (variety Orelha de Vó, 2022-2023 crop) infested with Fusarium at CCA/UFPB laboratory and greenhouse (Areia - PB/Brazil, 6°58'12″ S; 35°42'15″ W). Seeds were collected from field in the municipality of Remígio, Paraíba, Brazil (6° 57' 53.2\" S; 35° 47' 49.2\" W). Approximately 200 plants were inspected during this survey. Seedlings from these seeds were also infected, with 19% of them showing dwarfism and chlorosis, which are symptoms associated with Fusarium infections. Fusarium strains were isolated from symptomatic plants and then grown in pure culture on potato-dextrose-agar (PDA) and synthetic-nutrient-poor-agar (SNA) media. Monosporic cultures were obtained by transferring a single germinated conidium to fresh PDA plates to ensure culture purification. Colonies on PDA were floccous and dense varying from white to pale pink. Colonies on SNA were hyaline, with macroconidia measuring 20.8-13.9 × 5.7-4.1 μm, slightly falcate with three to four septa. Oval microconidia were abundant and formed on monophyalides, measuring 8.1-4.1 × 3.6-1.9 μm. Chlamydospores absent. Morphological features were consistent with the F. oxysporum species complex (Leslie & Summerell, 2006). To ensure the identification, a total of 2 isolates were obtained, and the isolate F25 was chosen as a representative for further analysis. The elongation factor 1α region (EF1-α) was amplified and sequenced using primers EF1 and EF2 (O'Donnell et al., 1998) and the RNA polymerase II second largest subunit (RPB2) using primers RPB2-5F2 (Reeb et al., 2004) and RPB2-7cR (Liu et al., 1999). Sequences generated in this study were deposited in GenBank (PQ045254 and PQ063816 for EF1-α and RPB2, respectively), and compared to other Fusarium species found at Fusarium-ID and GenBank databases. A phylogenetic analysis was inferred using a maximum likelihood and Bayesian inference, including previously published sequences (Nicolli et al., 2020). The EF1-α and RPB2 sequences shared 99.84% and 100% sequence identity with F. fabacearum CPC25802 (GenBank: MH485030.1 and MH484939.1, respectively). For the pathogenicity test, the isolate was cultured on PDA at 25 ± 2 °C for seven days. A F. fabacearum 5.0 × 10⁵ conidia/mL conidial suspension was prepared and used to immerse 100 lima bean seeds (variety Orelha de Vó, 2022-2023 crop) for five minutes. Inoculated seeds were then sown on sterile substrate in a greenhouse. Negative control was represented by seeds immersed in sterilized water. Typical dwarfism and chlorosis symptoms were observed on 29% of the emerged plants when compared to negative controls (healthy plants). The pathogen was reisolated from the symptomatic plants and phenotypically compared with the isolate inoculated, fulfilling Koch's postulates. This test was performed twice. This species was previously isolated from Glycine max L. and ","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144275548","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Evaluation of Field Pea Cultivars for Resistance to Pin Nematode (<i>Paratylenchus nanus</i> type B) in North Dakota.","authors":"Ekta Ojha, Gurminder Singh, Addison Plaisance, Guiping Yan","doi":"10.1094/PDIS-02-25-0356-RE","DOIUrl":"https://doi.org/10.1094/PDIS-02-25-0356-RE","url":null,"abstract":"<p><p>Pin nematodes (Paratylenchus spp.) are common plant-parasitic nematodes in North Dakota that can negatively impact field pea (Pisum sativum) production. These nematodes rely on a functional stylet to feed, which develops through molting from a non-feeding fourth-stage juvenile (J-4) into an adult. Understanding the role of host resistance and root exudates in triggering this molting process is crucial for effective nematode management. In this study, we evaluated 31 field pea cultivars for resistance to P. nanus type B in greenhouse experiments using naturally infested soil and investigated the influence of root exudates on J-4 molting under laboratory conditions. Reproductive factor (RF) was calculated as the final nematode population density divided by the initial density. Among the tested cultivars, six were classified as susceptible (Columbia, Carousel, Mystique, Flute, Banner, and Arcadia), twenty were moderately susceptible (DS Admiral, Ginny, Melrose, Korando, Capella, Bacurra, LG Amigo, CDC Striker, Granger, Spider, LG Sunrise, LG Koda, Fergie, SW Midas, Monarch, Nette, Hampton, Greenwood, K2, and Chrome), and five were moderately resistant (Matrix, Agassiz, Salamanca, Viper, and Aragorn). Additionally, root exudates from the susceptible cultivar Columbia induced molting up to 39% in J-4 nematodes, compared to only 6% in exudates from the moderately resistant cultivar Viper. This is the first report examining the effects of field pea root exudates on the molting of J-4 pin nematodes. Further studies on root exudate chemistry could provide deeper insights into host-nematode interactions. Overall, most cultivars supported nematode reproduction, underscoring the need for effective management strategies to mitigate nematode infestations.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144275549","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of <i>Neofusicoccum parvum</i> causing Branch Dieback and decline in Sweet Cherry (<i>Prunus avium</i>) in Chile.","authors":"Katherina Andrea Aguirre, Pablo Nuñez, Héctor Antonio Apablaza Donaire, Ysadora Fernández, Camila Farias, Victoria Barrientos, María Camila Morales","doi":"10.1094/PDIS-11-24-2428-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-11-24-2428-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Sweet cherry (&lt;i&gt;Prunus avium&lt;/i&gt; L.) is the primary tree fruit cultivated in Chile, with 70,686.29 ha currently planted, and it is the main exporter of sweet cherries in the Southern Hemisphere (www.ciren.cl, 2024). During the 2022 spring season (october), cherry trees in a commercial orchard in Calera de Tango, Metropolitan Region (33°39'42.8\"S 70°45'50.6\"W) showed decline symptoms, affecting 35% to over 50% of the trees. Symptoms included poor growth, chlorotic leaves, wood cankers, dead twigs, and dieback of branches, early defoliation and in several cases tree dead. Cross-sections of symptomatic branches revealed dark brown necrosis. Small pieces of symptomatic stems/branches (n=5) were surface disinfected with 70% ethanol and rinsed in sterile distilled water. Sections of inner bark and xylem tissue were cut from the margin of the necrotic lesion and transferred onto Petri dishes containing potato dextrose agar (PDA) supplemented with streptomycin and penicillin (100 mg/L). After 4 days of incubation at 25°C, five white and cottony colonies were observed. It was also evident how the aerial mycelium changed color with age to dark gray. Under the microscope, septate, branched hyphae were observed, which were either hyaline or melanized. Pycnidia and conidia were induced by incubating twigs in a humid chamber (&gt;80% RH) at 20°C in the dark for 10 days. Black, globose pycnidia developed on bark surfaces. Conidia were hyaline, unicellular, and ellipsoidal to fusiform, with truncated ends, measuring 25.07 - 38.16 (29.07) μm x 7.23-11.62 (9.46) μm (n=50), and a length/width ratio of 3.07. Based on morphology, isolates were preliminarily identified as &lt;i&gt;Neofusicoccum&lt;/i&gt; sp. A single-hyphal-tip culture (HK01) was used for molecular identification. The rDNA internal transcribed spacer (ITS), RNA polymerase II second largest subunit (Rpb2), and translation elongation factor 1-alpha (Ef1-α) partial gene regions were amplified by polymerase chain reaction (PCR) and sequenced using the primers ITS5/ITS4 (White et al. 1990), RPB2bot6F/RPB2bot7R (Sakalidis et al. 2011), and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. BLAST searches indicated the highest nucleotide sequences with the reference strains of &lt;i&gt;Neofusicoccum parvum&lt;/i&gt; CMW 9081 (ITS: 99.76%, AY236943; Rpb2: 100%, EU821963 y Ef1-α: 94.65%, AY236917). The identity of isolated HK01 was confirmed with multilocus phylogenetic analysis. Pathogenicity tests were conducted on 2-year-old 'Lapins', 'Kordia' and 'Santina' sweet cherry trees (n=3). Mycelial plugs (5 mm) from active culture were inoculated into wounds on the main stem and sealed with Parafilm; controls received PDA plugs only. The experiment was performed twice. After 6 months, the inoculated trees developed characteristic necrotic vascular lesions (length: 35-80 mm; width: 22-45 mm), and gummosis. However, control trees remained asymptomatic. The fungus was reisolated only from inoculated branches and molecularly identi","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144275550","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Genome-wide association studies of stripe rust resistance in spring wheat landraces from Northwest China.","authors":"Miaomiao Huang, Taiguo Liu, Youhua Yao, Wanquan Chen, Wanwei Hou, Liang Huang","doi":"10.1094/PDIS-02-25-0370-RE","DOIUrl":"https://doi.org/10.1094/PDIS-02-25-0370-RE","url":null,"abstract":"<p><p>Stripe rust is an important disease affecting wheat production around the world and poses a constant threat to yield. Discovery of new resistance genes is essential for long-term maintenance of resistance. This study used a group of 273 spring wheat landraces collected in northwest China to identify better sources of resistance to stripe rust. The landrace population was planted in five environments to assess adult plant resistance. Both genetic and environmental factors were associated with resistance variation. Several varieties, including Banjiemang, Gezanmai, and Datangsanyuemai, were found to be highly resistant in all environments. Population structure analysis divided the population into six subgroups and there were significant differences in stripe rust resistance responses between these subgroups. A genome-wide association study (GWAS) was performed using two algorithms to balance the false negative and false positive rates. Eight reliable quantitative traits loci (QTL) and their candidate genes were detected on chromosomes 1B, 2B, 3B, 5A, 6D and 7A. To determine the resistance of the identified QTL, we evaluated the seedling-stage infection responses of different genotypes to the stripe rust races CYR32 and CYR34. The pyramid effects of favorable alleles have been validated to improve resistance. The identified resistant varieties and QTL will be useful for further improving stripe rust resistance in wheat breeding.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144275551","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"An Evaluation of Pruning Programs to Manage Shoot Blight, Caused by the Bacterium <i>Erwinia amylovora</i>.","authors":"Isabella Magna Yannuzzi, Kerik D Cox","doi":"10.1094/PDIS-10-24-2144-RE","DOIUrl":"10.1094/PDIS-10-24-2144-RE","url":null,"abstract":"<p><p>Fire blight is an economically devastating disease caused by the bacterium <i>Erwinia amylovora.</i> Blossom infections can lead to shoot blight and, when unmanaged, become systemic and can quickly cause tree death and spread through an orchard via active infections sites producing bacterial ooze. With climate change, increasingly popular high-density training systems, and the susceptibility of many consumers' desired apple cultivars, shoot blight management has become exceptionally challenging despite the diverse management tactics available. To better understand pruning as a management practice, we evaluated 10 pruning programs in two different orchards over the course of 2 years. The pruning programs in this study encompass extension recommendations and grower preferences and include a variety of supplemental chemical applications and sanitation practices to answer three primary questions: (i) How do the impacts of pruning on the management of shoot blight compare between a vertical-axis orchard with mature trees and a high-density planting with young trees? (ii) Do sanitation and ancillary chemical management have a significant impact on shoot blight control achieved through pruning? (iii) How do a variety of pruning programs, including those preferred by researchers, growers, and extension agents, compare in terms of shoot blight management? The impacts of pruning programs were more pronounced in the vertical-axis orchard in terms of reducing infection spread and overall shoot blight incidence. However, in the high-density plantings, pruning programs were mostly ineffective and fire blight spread quickly throughout the trees and planting. Overall, the most aggressive pruning programs, which removed tissue of several seasons of growth, had the greatest impact on fire blight in both plantings. In line with the findings of many previous studies, sanitation or chemical management supplementation was not found to be necessarily beneficial.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":"PDIS10242144RE"},"PeriodicalIF":4.4,"publicationDate":"2025-06-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142896698","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First Report of <i>Fusarium subglutinans</i> Causing Leaf spot on <i>Dendrobium officinale</i> in China.","authors":"Youyan Lei, Shu He, Ziqiang Wu, Xiahong He, Jie Chen, Xin Hao","doi":"10.1094/PDIS-03-25-0619-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-03-25-0619-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;&lt;i&gt;Dendrobium officinale&lt;/i&gt;, a well-known traditional Chinese medicinal herb, is traditionally used to nourish Yin, clear heat, moisten the lungs, and promote fluid production. In November 2024, a symptom of leaf spot was observed in Longling County (24°38'18″N, 98°50'23″E), Baoshan City, Yunnan Province, China, with a disease incidence of 23% in the field. Initially, tiny yellow spots appeared on the upper surface of the leaves. These spots gradually enlarged, turning dark brown to black, and eventually caused the leaves to become chlorotic, transitioning from green to yellow. Five strains were obtained by the single-spore separation method on PDA plates. The colonies attained 57 mm in diameter on PDA in 5 days at 25 ℃, and were white to lavender, cottony, and the margin was regular and round. The macroconidia were cylindrical, slightly falcate, 1-5 septate, 20.28-38.52 × 2.93-4.8 μ m in size(n=50). The microconidia were aseptate, ellipsoid or reniform, 6.13-17.78 × 1.62-3.79 μm in size(n=50). The morphological characteristics of the isolates were consistent with the description of &lt;i&gt;Fusarium subglutinans&lt;/i&gt;. The RNA polymerase second-largest subunit partial genes (RPB2), RNA polymerase first largest subunit partial genes (RPB1) and translation elongation factor 1-alpha (TEF1-α) were amplified by the primers 5f2×7cr and 7cf×11ar, F8/R9, and EF1/EF2, respectively. All sequences were deposited in GenBank (PV236101 and PV236102 for RPB2, PV23610 and PV236104 for RPB1, PV236099 and PV236100 for TEF-α). BLAST analysis of the obtained sequence showed a homology of 99.57%, 99.53%, and 99.85% with &lt;i&gt;F. subglutinans&lt;/i&gt; sequences (KU171691, XM036687132, and KM213990, respectively). A maximum-likelihood phylogenetic tree was constructed using MEGA 11 software with 63 reference sequences, which supported the branching patterns within the &lt;i&gt;F. subglutinans&lt;/i&gt; clade. Based on morphological characteristics and molecular analysis, the isolates were identified as &lt;i&gt;F. subglutinans&lt;/i&gt;. Forty attached leaves were inoculated with a spore suspension (1×10⁶ spores/mL), while control leaves were inoculated with ddH₂O. All plants were covered with plastic bags to maintain 75% relative humidity at 25°C for 48 h. After 12 days, inoculated leaves exhibited symptoms identical to those observed in the field, whereas control plants remained asymptomatic. The pathogen was re-isolated from symptomatic leaves and identified as &lt;i&gt;F. subglutinans&lt;/i&gt; through morphological characterization and molecular analysis. Based on Koch's postulates, this study confirms that &lt;i&gt;D. officinale&lt;/i&gt; leaf spot is caused by F. subglutinans. This is the first report of leaf spot disease caused by &lt;i&gt;F. subglutinans&lt;/i&gt; in China. This study is significant for advancing effective management and control strategies for &lt;i&gt;D. officinale&lt;/i&gt; leaf spot disease. Additionally, these findings provide a theoretical foundation for developing disease control measures in &lt;i&gt;D. officinale&lt;/i&gt; cul","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-10","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144258712","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Surveying Potential Soilborne Pathogens Causing Sett Rot on Sugarcane in Southern Florida.","authors":"Tarciso Almeida Ferreira Junior, Igor Erhardt, Fernanda R Silva, Alba Myers, Katia V Xavier","doi":"10.1094/PDIS-02-25-0404-SR","DOIUrl":"https://doi.org/10.1094/PDIS-02-25-0404-SR","url":null,"abstract":"<p><p>The transition from manual to mechanical planting in Florida has raised concerns about the impact of mechanical harvesting on seed cane integrity, increasing the potential for infection by naturally occurring soilborne pathogens. As part of this study, surveys conducted during the 2023 and 2024 planting seasons identified <i>Thielaviopsis</i> sp. and <i>Fusarium</i> sp. in 43% and 38% of the 568 sampled seed cane, respectively. Statistical analyses revealed a positive correlation between muck soils and <i>Thielaviopsis</i> occurrence, however <i>Fusarium</i> incidence appeared to be independent of soil type. Among sugarcane varieties, CP07-2320 exhibited negative correlation to <i>Thielaviopsis</i> but was positively correlated to Fusarium. In contrast, CP96-1252 was particularly correlated to <i>Thielaviopsis</i> and negatively correlated to <i>Fusarium</i>. Of particular interest to growers, CPCL05-1201 demonstrated moderate correlation to both pathogens. Spatial analyses using Kernel Density Estimation highlighted pathogen hotspots, aligning with varietal correlation trends to the two pathogens. This study provides insights for local growers, enabling more informed decisions for targeted disease management, particularly in optimizing variety selection and field practices to mitigate disease risks. These contributions support the sustainable transition to mechanical planting in sugarcane production while offering broader implications for managing soilborne diseases in other agricultural systems.</p>","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-10","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144258714","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"First report of Fusarium wilt of <i>Brassica juncea</i> caused by <i>Fusarium commune</i> in Hawai'i.","authors":"Roshan Paudel, Achyut Raj Adhikari, Lauren E Braley, Jane Marian Luis, Joshua Silva, Koon-Hui Wang","doi":"10.1094/PDIS-04-25-0728-PDN","DOIUrl":"https://doi.org/10.1094/PDIS-04-25-0728-PDN","url":null,"abstract":"&lt;p&gt;&lt;p&gt;Severe wilting of mustard green (Brassica juncea) was observed in a commercial leafy green farm in Wai'anae, Hawai'i. The disease incidence was approximately 50% in the 1.5 ha planted with 'Hirayama' mustard green. Diseased plants showed symptoms of wilting, vascular discoloration, and root rot. In 2024, 40 plants were collected for pathogen isolation. Subsample of roots and crown parts of infected plants was first rinsed under tap water to remove soil particles. Root and crown tissues were cut into 1 cm pieces, surface sterilized with 0.8 % NaOCl for 30 seconds, rinsed with distilled water three times, and plated on Komada agar (Komada, 1975). Fungal growth was observed on the surface of all the plated roots. After 2 days, tips of fungal colonies were transferred to Komada agar and potato dextrose agar (PDA). Two distinct types of colony morphology were observed on Komada plates, whereas only one type of morphology was observed on PDA. Three representatives of single conidium isolates (PCT-1, KCT-1, and KCT-2) from the three morphological types were used for molecular identification. The translation elongation factor 1 (TEF-1) gene was amplified by PCR using primers (TEF1: ATGGGTAAGGARGACAAGAC and TEF2: GGARGTACCAGTSATCAT) (O'Donnell et al. 1998). The mitochondrial small subunit rDNA (mtSSU) gene was amplified using primers (mtSSU1: GCCATAGGTCAGATAACCAGTT and mtSSU2: TCACTACTGGTGTCAGAAACGG) (Zhu et al. 2016). Additionally, the internal transcribed spacer (ITS) region was amplified using primers (ITS4: TCCTCCGCTTATTGATATGC and ITS5: GGAAGTAAAAGTCGTAACAAGG) (White et al. 1990). Amplicons from the isolates showed 100% identity to F. commune accessions in NCBI database. Although F. commune sequences appeared as top hits for all three genes, mtSSU and ITS sequences amplified were also mapped to other Fusarium species. The sequences were deposited in GenBank with accession number PQ047448(TEF1), PQ047130(mtSSU), and PQ012232(ITS). In the multiloci-phylogenetic tree generated from the sequence data of the above three genes in conjunction with the other reference sequences (Wang et al., 2018), our isolate clustered with the representative strains of F. commune. After confirming all three isolates as F. commune, isolate PCT-1 was selected for pathogenicity tests together with morphological and molecular analyses. On PDA, isolate PCT-1 initially produced white, dense aerial mycelium and later appeared orange-white to pink. Chlamydospore formation occurred in sealed PDA plates incubated in the dark at 22°C for 14 days. The macroconidia from PDA plates stored at 22°C were slightly curved, hyaline, contained 3 to 5 septa, and measured 39.5 ± 5.4 µm long (mean ± SD, n = 50). Microconidia were cylindrical, oblong, aseptate, and measured 16.1 ± 3.2 µm long (mean ± SD, n = 50). These morphological characteristics aligned with the type species description of F. commune (Skovgaard et al. 2003). Pathogenicity tests were carried out twice using 3-week-old B. j","PeriodicalId":20063,"journal":{"name":"Plant disease","volume":" ","pages":""},"PeriodicalIF":4.4,"publicationDate":"2025-06-10","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144258713","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"农林科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}