HematologyPub Date : 2025-12-01Epub Date: 2025-02-20DOI: 10.1080/16078454.2025.2460895
Wei Shui, Yuanyuan Niu, Changran Zhang, Qianying Pan
{"title":"Investigating the correlation between blood manganese concentrations and anemia in U.S. adults: a nationally representative study.","authors":"Wei Shui, Yuanyuan Niu, Changran Zhang, Qianying Pan","doi":"10.1080/16078454.2025.2460895","DOIUrl":"10.1080/16078454.2025.2460895","url":null,"abstract":"<p><strong>Background: </strong>The health implications of trace elements have become increasingly concerning, yet the connection between blood manganese levels and anemia remains insufficiently examined. This research endeavors to explore the potential linkage between blood manganese concentrations and anemia.</p><p><strong>Methods: </strong>Utilizing data from the National Health and Nutrition Examination Survey (NHANES) from 2011 to 2018, this study examines the correlation between blood manganese levels and anemia among U.S. adults, offering a comprehensive national perspective. The study included 11,300 adults aged 20 and above, with both blood manganese and hemoglobin levels measured. Generalized Additive Model (GAM) was applied to delineate smooth curves, and threshold effect analysis was performed to identify the inflection points of these curves. Subsequently, unconditional logistic regression was employed to assess the risk.</p><p><strong>Results: </strong>Our research involved a total of 11,300 individuals, among which 1,143 (10.1%) were identified with anemia. The curve fitting analysis indicated a U-shaped relationship between blood manganese levels and the risk of anemia. Specifically, when blood manganese levels were below 8.69 µg/L, increasing concentrations were linked to a decreased risk of anemia, with an adjusted OR of 0.838 (95% CI: 0.735-0.954), indicating a protective effect of this level of blood manganese against anemia. Conversely, when blood manganese levels were at or above 8.69 µg/L, further elevations were strongly associated with an increased risk of anemia, with the adjusted OR rising to 1.160 (95% CI: 1.124-1.196), suggesting that excessively high blood manganese levels significantly raised the risk of developing anemia.</p><p><strong>Conclusion: </strong>This study provides novel insights into the association between blood manganese levels and anemia. Further extensive, population-based cohort studies are necessary to validate the causality and to uncover the intrinsic toxicological mechanisms.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2460895"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143467880","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
HematologyPub Date : 2025-12-01Epub Date: 2025-02-07DOI: 10.1080/16078454.2024.2449319
Bi Zhou, WenPeng Wang, Pao Yu, Yang Yang, DaWei Mi, YuanYuan Tian, Ying Li, Feng Zhu
{"title":"Expression and clinical significance of histamine receptors in pediatric AML.","authors":"Bi Zhou, WenPeng Wang, Pao Yu, Yang Yang, DaWei Mi, YuanYuan Tian, Ying Li, Feng Zhu","doi":"10.1080/16078454.2024.2449319","DOIUrl":"10.1080/16078454.2024.2449319","url":null,"abstract":"<p><strong>Background: </strong>This study investigates the expression and clinical significance of the histamine receptor family (HRs) in the bone marrow of children with newly diagnosed acute myeloid leukemia (AML).</p><p><strong>Methods: </strong>RNA sequencing was performed to assess the expression levels of HR family members (HRH1, HRH2, HRH3, and HRH4) in the bone marrow of 140 pediatric AML patients prior to chemotherapy. We compared the expression levels across various risk categories and assessed their relationship with prognosis using ROC curve analysis to evaluate predictive capabilities for outcomes.</p><p><strong>Results: </strong>Among the 140 AML patients in our center, those with different FAB subtypes showed varying overall survival (OS), event-free survival (EFS), and relapse-free survival (RFS). Specifically, the M2 and M4 subtypes showed better OS, EFS, and RFS, whereas the M5 subtype had poorer outcomes. Among patients with different fusion genes, those with AML1/ETO had superior OS, EFS, and RFS compared to other subtypes. Additionally, patients with CEBPA mutations demonstrated relatively favorable outcomes, whereas those with FLT3 mutations had poorer survival metrics. HRH1 expression was significantly higher in AML patients than in normal controls (<i>P</i> < 0.05). Patients in the high HRH1 expression group had significantly better EFS and RFS than those in the low expression group (<i>P </i>< 0.05). Furthermore, HRH1 expression was significantly higher in the low-risk (LR) group than in the intermediate and high-risk (IR & HR) groups (<i>P</i> < 0.05). This finding suggests that HRH1 may serve as an early predictor of risk, EFS, and RFS.</p><p><strong>Conclusion: </strong>The clinical significance of HR family members varies in pediatric AML, with HRH1 identified as a valuable predictor of relapse in children with AML.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2449319"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143370767","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML.","authors":"Yi-Zi Liu, Feng-Hong Zhang, Chun-Xiao Hou, Zhi-Yu Zhang, Yi-Yan Zhu, Qian Wang, Yu Chen, Su-Ning Chen","doi":"10.1080/16078454.2024.2439110","DOIUrl":"10.1080/16078454.2024.2439110","url":null,"abstract":"<p><strong>Objective: </strong>Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While <i>MTCP1</i> is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the <i>GATAD2B::MTCP1</i> fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).</p><p><strong>Methods: </strong>The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The <i>GATAD2B::MTCP1</i> fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (<i>GATAD2B</i>-F: CCTCTTTTTTTCGACGCC; <i>MTCP1</i>-R: ACTGAGCACAACACTTACGC).</p><p><strong>Results: </strong>The <i>GATAD2B::MTCP1</i> fusion results from a breakpoint on 1q21 within <i>GATAD2B</i> exon 1 and Xq28 within <i>MTCP1</i> exon 2. The patient with the <i>GATAD2B::MTCP1</i> fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.</p><p><strong>Conclusions: </strong>We propose that the <i>GATAD2B::MTCP1</i> fusion upregulates <i>MTCP1</i> expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2439110"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142854224","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
HematologyPub Date : 2025-12-01Epub Date: 2025-01-08DOI: 10.1080/16078454.2024.2439605
Hui Fu, Yanmin Zhao, Huarui Fu, Meng Liu, Congxiao Zhang, Li Yang, He Huang, Jimin Shi, Jian Yu
{"title":"Blinatumomab added to conditioning regimen of allogeneic hematopoietic stem cell transplantation for adult MRD<i>-</i>positive acute lymphoblastic leukemia: a single-center case series.","authors":"Hui Fu, Yanmin Zhao, Huarui Fu, Meng Liu, Congxiao Zhang, Li Yang, He Huang, Jimin Shi, Jian Yu","doi":"10.1080/16078454.2024.2439605","DOIUrl":"10.1080/16078454.2024.2439605","url":null,"abstract":"<p><p>Allogeneic hematopoietic stem cell transplantation (Allo-HSCT) remains the mainstay of treatment for adults with high-risk acute lymphoblastic leukemia (ALL). Due to the crucial role of measurable residual disease (MRD) before Allo-HSCT in predicting relapse and the promising anti-leukemia effect of blinatumomab, we documented a short-course, low-dose conditioning regimen incorporating blinatumomab for Allo-HSCT in three ALL patients with positive MRD. Following the administration of the blinatumomab-containing conditioning regimen, all patients attained complete remission (CR) with negative MRD status, and no severe adverse events were observed. After a 2-year follow-up, 2/3 of patients remained disease-free and attained long-term survival following transplantation. These cases indicated a short-term blinatumomab conditioning regimen may effectively prolong patient survival, improve prognosis, and offer a safe and cost-effective treatment for high-risk ALL patients with positive MRD. The addition of blinatumomab to the conditioning regimen of Allo-HSCT is feasible for high-risk ALL patients with positive MRD.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2439605"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142948187","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
HematologyPub Date : 2025-12-01Epub Date: 2024-12-19DOI: 10.1080/16078454.2024.2434276
Fei Wang, Luo Lu, Haoyu Zang, Yanhua Yue, Yang Cao, Min Chen, Yue Liu, Weiying Gu, Bai He
{"title":"Malnutrition defined by Controlling Nutritional Status score was independently associated with prognosis of diffuse large B-cell lymphoma primarily on elderly patients.","authors":"Fei Wang, Luo Lu, Haoyu Zang, Yanhua Yue, Yang Cao, Min Chen, Yue Liu, Weiying Gu, Bai He","doi":"10.1080/16078454.2024.2434276","DOIUrl":"https://doi.org/10.1080/16078454.2024.2434276","url":null,"abstract":"<p><strong>Objectives: </strong>Controlling Nutritional Status (CONUT) Score is an effective tool for the assessment of malnutrition and proved to be associated with survival of Diffuse large B-cell lymphoma (DLBCL) patients. We investigated the impact of CONUT score on specific subgroups of DLBCL patients, including age and International prognostic Index (IPI) risk groups.</p><p><strong>Methods: </strong>Data of 287 newly diagnosed DLBCL in the Third Affiliated Hospital of Soochow University were retrospectively collected. Baseline CONUT score, clinical data and survival information were recorded.</p><p><strong>Results: </strong>With the standard cut-off value of 4 points, 88 (30.7%) patients were clarified as malnourished. During a median follow-up of 34 months, malnourished patients exhibited significant reduction in both progression-free survival (PFS) and overall survival (OS). The 3-year PFS rates for malnourished and well-nourished patients were 51.4% and 70.9% (<i>p</i> = 0.001), while the 3-year OS rates were 62.4% and 84.0% (<i>p</i> < 0.001). Malnutrition was demonstrated an independent predictor of OS in DLBCL patients (HR 2.220, 95% CI 1.307-3.772, <i>p</i> = 0.003). It could effectively identify patients with inferior OS in both low/intermediate-low risk and intermediate-high/high risk IPI groups. In the group of elderly patients aged over 60 years, malnutrition was independently associated with OS (HR 2.182, 95% CI 1.178-4.040, <i>p </i>= 0.024), but not PFS (HR 1.709, 95% CI 1.016-2.875, <i>p</i> = 0.070) after adjustment using the Benjamini-Hochberg procedure. Conversely, for younger patients, malnutrition did not demonstrate an independent impact on either PFS or OS.</p><p><strong>Conclusion: </strong>Malnutrition evaluated by CONUT score was an independent predictor for the outcome of DLBCL patients, which is exclusively caused by its effect on elderly patients.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2434276"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142852916","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
HematologyPub Date : 2025-12-01Epub Date: 2025-07-30DOI: 10.1080/16078454.2025.2538950
Hong-Kai Cai, Lin Jiang, Jian-Bin Gong, Wen-da Luo, Xia-Yin Zhu
{"title":"Association between lymphocyte-associated ratios, C-reactive protein and prognostic value in myelodysplastic syndromes.","authors":"Hong-Kai Cai, Lin Jiang, Jian-Bin Gong, Wen-da Luo, Xia-Yin Zhu","doi":"10.1080/16078454.2025.2538950","DOIUrl":"https://doi.org/10.1080/16078454.2025.2538950","url":null,"abstract":"<p><strong>Purpose: </strong>This study was designed to investigate the relationship between peripheral blood inflammatory markers and prognosis in MDS patients.</p><p><strong>Methods: </strong>We conducted a study involving 183 MDS patients who were diagnosed at Taizhou Hospital of Zhejiang Province and Enze Hospital between January 2015 and December 2019. The end point of follow-up was September 2022. To minimize the impact of other confounding factors among the 110 included MDS patients, X-tile software was used to determine the optimal cutoff points for peripheral blood inflammation markers. Based on these cutoff points, the cohort of patients was divided into a high-risk group and a low-risk group. The OS in each group was analyzed by the Kaplan-Meier method, and univariate and multivariate Cox regression analyses were employed.</p><p><strong>Results: </strong>The MDS patients included 73 men and 37 women with a median age of 72 years (32-92 years). The median OS was 28 months (1-83 months), 17 patients (15.45%) experienced conversion to AML, and 94 patients (85.45%) died during the follow-up period. The optimal cutoff points were ALC (1.2 × 10<sup>9</sup>/L), AMC (0 × 10<sup>9</sup>/L), CRP (6.1 mg/L), MLR (0.125), NLR (2.25) and PLR (71.4). Patients in the ALC (≤1.2 × 10<sup>9</sup>/L, <i>P</i> = 0.017), MLR (>0.125, <i>P</i> = 0.01), PLR (>71.43, <i>P</i> = 0.044), and CRP (>6.1 mg/L, <i>P</i> < 0.0001) groups had shorter overall survival. The MLR (>0.125, <i>P</i> = 0.011) and CRP (>6.1 mg/L, <i>P</i> = 0.017) levels were related to poor prognosis.</p><p><strong>Conclusions: </strong>Elevated MLR and CRP levels may be independent indicators of poor prognosis in newly diagnosed MDS patients.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2538950"},"PeriodicalIF":1.6,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144742038","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
HematologyPub Date : 2025-12-01Epub Date: 2025-02-06DOI: 10.1080/16078454.2025.2462249
Yin-Che Wang, Cheng-Hsien Lin, Yu-Chen Su, Chieh-Lin Jerry Teng
{"title":"Bortezomib, thalidomide, and dexamethasone versus bortezomib, lenalidomide, and dexamethasone in transplant-eligible newly diagnosed multiple myeloma: a systemic review and meta-analysis.","authors":"Yin-Che Wang, Cheng-Hsien Lin, Yu-Chen Su, Chieh-Lin Jerry Teng","doi":"10.1080/16078454.2025.2462249","DOIUrl":"10.1080/16078454.2025.2462249","url":null,"abstract":"<p><strong>Background: </strong>The current study aimed to compare treatment responses, the incidence of the need for auto-HSCT, and the occurrence of specific adverse events (AEs) between VTD and velcade, VRD induction regimens in patients with transplant-eligible newly diagnosed multiple myeloma (NDMM).</p><p><strong>Methods: </strong>This systematic review and meta-analysis included 15 studies: six evaluating the VTD regimen and nine evaluating the VRD one. The primary endpoints were response rates after induction therapy and the incidence of a need for autologous hematopoietic stem cell transplantion (auto-HSCT) between the groups. We also examined the occurrence of grade 3 or 4 hematological, infection, and thrombotic AEs in both groups.</p><p><strong>Results: </strong>The VTD group showed an overall response rate (ORR) of 93%, while the VRD group had an ORR of 86%. The very good partial response (VGPR) rates were 61% in the VTD group and 60% in the VRD one. The auto-HSCT rate was higher in the VTD group, averaging 93% compared to 70% in the VRD one. The incidence of grade 3 or 4 hematological AEs was 31% for VTD and 33% for VRD. The rates of grade 3 or 4 infection-related AEs were 9% in the VTD group and 14% in the VRD one. The incidence of grade 3 or 4 thrombotic AEs was 4% for VTD and 3% for VRD.</p><p><strong>Conclusions: </strong>With comparable safety profiles, VTD and VRD induction therapies are similarly effective for transplant-eligible NDMM, showing similar ORRs and VGPR rates.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2462249"},"PeriodicalIF":1.6,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"143364445","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"The role of METTL14 in the progression of chronic myeloid leukemia.","authors":"Jing Zhang, Zhi-Hua Liao, Yan-Mei Xu, Shu-Qi Li, Fang-Min Zhong, Ling Zhang, Fang-Yi Yao, Qin Bai, Li-Hua Yao, Bo Huang, Jing Liu, Xiao-Zhong Wang","doi":"10.1080/16078454.2025.2535819","DOIUrl":"https://doi.org/10.1080/16078454.2025.2535819","url":null,"abstract":"<p><strong>Objectives: </strong>Chronic myeloid leukemia (CML), a clonal malignant disease arising from the BCR-ABL fusion gene, presents significant therapeutic challenges, particularly in chemotherapy resistance. The role of METTL14, a key m6A methyltransferase, is implicated in cancer biology, but its role in CML remains unclear.</p><p><strong>Methods: </strong>Peripheral blood mononuclear cells (PBMCs) and CML cell lines (K562 and K562/G01) were conducted in vitro studies. mRNA levels were quantified by quantitative PCR (qPCR), and protein expressions were assessed by Western Blotting. Cell viability and apoptosis were measured using the CCK-8 and flow cytometry, respectively. Drug resistance was evaluated by determining the half-maximal inhibitory concentration (IC50). m6A levels were quantified using liquid chromatography-tandem mass spectrometry (LC-MS/MS), and modification sites were predicted by SRAMP and confirmed with a SELECT detection assay. Gene interactions were validated through luciferase assays.</p><p><strong>Results: </strong>METTL14 expression was significantly elevated in imatinib-resistant CML patients (P=0.005) and K562/G01 cells (P=0.01), correlating with increased m6A modification levels (P=0.032). Overexpression of METTL14 enhanced m6A methylation, promoted cell proliferation, inhibited apoptosis, and increased imatinib resistance in CML cells. Conversely, METTL14 silencing reduced m6A levels, induced G0/G1 arrest, and enhanced apoptosis (P=0.01). Mechanistically, the luciferase assay results demonstrated that METTL14-mediated m6A modification at the A1001 site of Bcl-x mRNA facilitated HNRNPC-dependent splicing. Consequently, this modification results in shifting Bcl-xS to Bcl-xL and inactivating the BCL-2/BAX/Caspase-3 pathway.</p><p><strong>Conclusion: </strong>METTL14-driven m6A modification regulates the splicing pattern of Bcl-x, and may facilitate the progression of CML. Keywords: CML, METTL14, N6-methyladenine, Bcl-x, Alternative splicing, resistance, imatinib, progression.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2535819"},"PeriodicalIF":1.6,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144784215","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
HematologyPub Date : 2025-12-01Epub Date: 2025-08-06DOI: 10.1080/16078454.2025.2538307
Jie Wang, Na Wei, Jingshi Wang, Lin Wu, Hongli Hu, Zhao Wang
{"title":"The effectiveness of etoposide-containing chemotherapy regimens in the initial treatment of Hemophagocytic Syndrome in pregnancy.","authors":"Jie Wang, Na Wei, Jingshi Wang, Lin Wu, Hongli Hu, Zhao Wang","doi":"10.1080/16078454.2025.2538307","DOIUrl":"https://doi.org/10.1080/16078454.2025.2538307","url":null,"abstract":"<p><strong>Objective: </strong>To summarize the clinical characteristics, treatment outcomes, and prognosis of pregnant patients with hemophagocytic lymphohistiocytosis (HLH), and to evaluate the efficacy of chemotherapy regimens containing etoposide (VP16) in these patients and their impact on survival outcomes.</p><p><strong>Methods: </strong>A retrospective analysis was performed on 41 pregnant HLH patients admitted to our hospital between April 2015 and March 2024, focusing on clinical features, treatment strategies, and prognostic factors.</p><p><strong>Results: </strong>Among the 41 cases, 29 developed HLH during pregnancy and 12 postpartum. Etiologies included malignancy-related HLH (5 cases), Epstein-Barr virus (EBV)-related HLH (5 cases), rheumatologic disease-related HLH (2 cases), and pregnancy-related HLH (29 cases, defined as no comorbid HLH-related etiologies except pregnancy). In pregnancy-related HLH patients presenting during gestation, the 2-week overall response rate (ORR) was significantly higher in those receiving VP16-containing induction chemotherapy compared to glucocorticoids-only induction therapy (<i>P</i> = 0.011). Multivariate analysis identified the interval from symptom onset to VP16 initiation as an independent prognostic factor for pregnancy-related HLH (<i>P</i> = 0.025). Survival analysis revealed improved survival in patients who received VP16 within 7 weeks of onset versus those treated after 7 weeks (<i>P</i> = 0.044).</p><p><strong>Discussion and conclusion: </strong>HLH in pregnancy progresses rapidly. Early administration of VP16-containing chemotherapy significantly improves ORR and survival outcomes, particularly in pregnancy-related HLH.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2538307"},"PeriodicalIF":1.6,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"144794260","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Clinical characteristics and prognostic analysis of <i>CDKN2A/2B</i> gene in pediatric acute lymphoblastic leukemia: a retrospective case-control study.","authors":"Shi-Mei Huang, Hui-Qin Chen, Li-Ting Liu, Ya-Ting Zhang, Jian Wang, Dun-Hua Zhou, Jian-Pei Fang, Lu-Hong Xu","doi":"10.1080/16078454.2024.2439606","DOIUrl":"https://doi.org/10.1080/16078454.2024.2439606","url":null,"abstract":"<p><p>In this retrospective case-control study involving 424 pediatric patients diagnosed with Pediatric Acute Lymphoblastic Leukemia (ALL), the investigation focused on analyzing the clinical characteristics and prognosis associated with the Cyclin-dependent kinase inhibitor 2A/2B (<i>CDKN2A/2B</i>) gene. Treatment and evaluation followed the South China Children's Leukemia Group-ALL-2016 protocol (SCCLG-ALL-2016). Among the cohort, 92 patients (21.7%) exhibited <i>CDKN2A/2B</i> gene deletions, with 11.1% homozygous and 10.6% heterozygous deletions. Notably, ALL patients that do have <i>CDKN2A/2B</i> gene deletions tended to present at an older age (<i>P </i>= 0.001), demonstrate hepatosplenomegaly on palpation (<i>P </i>< 0.001), and exhibit a higher incidence of Central nervous system leukemia (CNSL) (<i>P </i>= 0.037) and T-ALL (<i>P </i>= 0.007). A significant correlation was observed between ALL that does have <i>CDKN2A/2B</i> gene deletions and <i>ETV6::RUNX1-positive</i> (8.7% vs. 19.3%, <i>P </i>= 0.017) and <i>IKZF1</i> gene deletions (20.7% vs. 8.4%, <i>P </i>= 0.001). Survival analysis of 392 patients revealed no significant differences in 5-year relapse, Overall survival (OS), or Event-free survival (EFS) between ALL that does/ does not have <i>CDKN2A/2B</i> gene deletions. Subgroup analysis highlighted poorer prognosis among hepatosplenomegaly patients in the <i>CDKN2A/2B</i> gene deletion group, with a 5-year EFS of 81.8%, 95%CI (0.695-0.963), <i>P </i>= 0.05. Hepatosplenomegaly emerged as the most significant prognostic factor for EFS [HR = 2.306, 95%CI (1.192-4.461), <i>P </i>= 0.013]. Cox regression analyses identified covariates influencing prognosis, ALL with the <i>CDKN2A/2B</i> gene showing no significant impact on outcomes. In conclusion, while ALL that does have <i>CDKN2A/2B</i> gene deletions is associated with certain clinical characteristics and genetic aberrations, they did not significantly impact OS or EFS. Furthermore, subgroup analysis revealed a potential prognostic role of ALL that does have <i>CDKN2A/2B</i> deletions presenting with hepatosplenomegaly on palpation, emphasizing the importance of comprehensive risk stratification in treatment decision-making for this subgroup.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2439606"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142828387","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}