Advances in cell and gene therapy最新文献

{"title":"Inadvertent Transfer of Murine VL30 Retrotransposons to CAR-T Cells.","authors":"Sung Hyun Lee,&nbsp;Yajing Hao,&nbsp;Tong Gui,&nbsp;Gianpietro Dotti,&nbsp;Barbara Savoldo,&nbsp;Fei Zou,&nbsp;Tal Kafri","doi":"10.1155/2022/6435077","DOIUrl":"https://doi.org/10.1155/2022/6435077","url":null,"abstract":"<p><p>For more than a decade, genetically engineered autologous T-cells have been successfully employed as immunotherapy drugs for patients with incurable blood cancers. The active components in some of these game-changing medicines are autologous T-cells that express viral vector-delivered chimeric antigen receptors (CARs), which specifically target proteins that are preferentially expressed on cancer cells. Some of these therapeutic CAR expressing T-cells (CAR-Ts) are engineered via transduction with <i>γ</i>-retroviral vectors (<i>γ</i>-RVVs) produced in a stable producer cell line that was derived from murine PG13 packaging cells (ATCC CRL-10686). Earlier studies reported on the copackaging of murine virus-like 30S RNA (VL30) genomes with <i>γ</i>-retroviral vectors generated in murine stable packaging cells. In an earlier study, VL30 mRNA was found to enhance the metastatic potential of human melanoma cells. These findings raise biosafety concerns regarding the possibility that therapeutic CAR-Ts have been inadvertently contaminated with potentially oncogenic VL30 retrotransposons. In this study, we demonstrated the presence of infectious VL30 particles in PG13 cell-conditioned media and observed the ability of these particles to deliver transcriptionally active VL30 genomes to human cells. Notably, VL30 genomes packaged by HIV-1-based vector particles transduced naïve human cells in culture. Furthermore, we detected the transfer and expression of VL30 genomes in clinical-grade CAR-T cells generated by transduction with PG13 cell-derived <i>γ</i>-retroviral vectors. Our findings raise biosafety concerns regarding the use of murine packaging cell lines in ongoing clinical applications.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9450689/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"33454756","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Genomic Designs of rAAVs Contribute to Pathological Changes in the Livers and Spleens of Mice.","authors":"Patrick L Mulcrone,&nbsp;Junping Zhang,&nbsp;P Melanie Pride,&nbsp;Anh K Lam,&nbsp;Dylan A Frabutt,&nbsp;Susan M Ball-Kell,&nbsp;Weidong Xiao","doi":"10.1155/2022/6807904","DOIUrl":"https://doi.org/10.1155/2022/6807904","url":null,"abstract":"<p><p>Recombinant AAV (rAAV) gene therapy is being investigated as an effective therapy for several diseases including hemophilia B. Reports of liver tumor development in certain mouse models due to AAV treatment and genomic integration of the rAAV vector has raised concerns about the long-term safety and efficacy of this gene therapy. To investigate whether rAAV treatment causes cancer, we utilized two mouse models, inbred C57BL/6 and hemophilia B Balb/C mice (HemB), to test if injecting a high dose of various rAAV8 vectors containing or lacking hFIX transgene, a Poly-A sequence, or the CB or TTR promoter triggered liver fibrosis and/or cancer development over the course of the 6.5-month study. We observed no liver tumors in either mouse cohort regardless of rAAV treatment through ultrasound imaging, gross anatomical assessment at sacrifice, and histology. We did, however, detect differences in collagen deposition in C57BL/6 livers and HemB spleens of rAAV-injected mice. Pathology reports of the HemB mice revealed many pathological phenomena, including fibrosis and inflammation in the livers and spleens across different AAV-injected HemB mice. Mice from both cohorts injected with the TTR-hFIX vector demonstrated minimal adverse events. While not tumorigenic, high dose of rAAVs, especially those with incomplete genomes, can influence liver and spleen health negatively that could be problematic for cementing AAVs as a broad therapeutic option in the clinic.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9730939/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"10757801","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Identification of homologous human miRNAs as antivirals towards COVID-19 genome","authors":"Jitender Singh,&nbsp;Ashvinder Raina,&nbsp;Namrata Sangwan,&nbsp;Arushi Chauhan,&nbsp;Krishan L. Khanduja,&nbsp;Pramod K. Avti","doi":"10.1002/acg2.114","DOIUrl":"10.1002/acg2.114","url":null,"abstract":"<p>The COVID-19 fatality rate is ~57% worldwide. The investigation of possible antiviral therapy using host microRNA (miRNA) to inhibit viral replication and transmission is the need of the hour. Computational techniques were used to predict the hairpin precursor miRNA (pre-miRNAs) of COVID-19 genome with high homology towards human (host) miRNA. Top 21 host miRNAs with &gt;80% homology towards 18 viral pre miRNAs were identified. The Gibbs free energy (ΔG) between host miRNAs and viral pre-miRNAs hybridization resulted in the best 5 host miRNAs having the highest base-pair complementarity. miR-4476 had the strongest binding with viral pre-miRNA (ΔG = −21.8 kcal/mol) due to maximum base pairing in the seed sequence. Pre-miR-651 secondary structure was most stable due to the (1) least minimum free energy (ΔG = −24.4 kcal/mol), energy frequency, and noncanonical base pairing and (2) maximum number of stem base pairing and small loop size. Host miRNAs–viral mRNAs interaction can effectively inhibit viral transmission and replication. Furthermore, miRNAs gene network and gene-ontology studies indicate top 5 host miRNAs interaction with host genes involved in transmembrane-receptor signaling, cell migration, RNA splicing, nervous system formation, and tumor necrosis factor-mediated signaling in respiratory diseases. This study identifies host miRNA/virus pre-miRNAs strong interaction, structural stability, and their gene-network analysis provides strong evidence of host miRNAs as antiviral COVID-19 agents.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-09-13","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.114","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"39833594","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Immunological tumor heterogeneity and diagnostic profiling for advanced and immune therapies","authors":"Ralf Huss,&nbsp;Christoph Schmid,&nbsp;Mael Manesse,&nbsp;Jeppe Thagaard,&nbsp;Bruno Maerkl","doi":"10.1002/acg2.113","DOIUrl":"10.1002/acg2.113","url":null,"abstract":"<p>Immunotherapies have changed the way how we treat cancer at all stages. The understanding of the immune system in individual tumor specimens guides the selection of immune-modulating agents such as immune checkpoint inhibitors alone or in combination with other therapeutic agents that target, modulate or unleash the patient's immune system. Despite the similar histopathological diagnosis, each tumor is unique at its primary site and site of metastasis, also depending on previous treatment regimens or genetic alterations, such as chromosomal instability or acquired mutations. The clinically well-established use of PD-1/PD-L1 inhibitors already requires the assessment of its target molecules in different cells (viable tumor cells alone or in combination with immune cells or immune cells alone) with different thresholds in various indications. Anyhow, checkpoint inhibitors show the best overall response rate when immune effector cells like tumor-infiltrating lymphocytes are in close spatial proximity without being suppressed by other humoral or cellular regulatory mechanisms. Therefore, immune cell-rich tumors (“hot tumors”) are usually quite reactive to immune-modulating agents, whereas other immune-depleted or immune-excluded tumor areas are less responsive and require alternative treatment regimens such as modified immune effectors cells or immune-stimulating agents, for example, oncolytic viruses. Here, we summarize the relevance to understand the entire tumor heterogeneity and its environment, the contextual relationship and spatial quantification of all immune and tumor cells along with the genetic background of the individual cancer through the application of multiplex in-situ technologies and the application of machine learning tools.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-06-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.113","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"43339491","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Inhospital morbidity and mortality among acute myeloid leukemia patients admitted for hematopoietic stem cell transplantation between 2002-2017","authors":"Saqib Abbasi,&nbsp;Joseph Bennett,&nbsp;Osama Diab,&nbsp;Ghulam Rehman Mohyuddin,&nbsp;Anurag Singh","doi":"10.1002/acg2.112","DOIUrl":"10.1002/acg2.112","url":null,"abstract":"","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-05-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.112","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"46842051","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"An in silico analysis of effective siRNAs against COVID-19 by targeting the leader sequence of SARS-CoV-2","authors":"Anand Kumar Pandey,&nbsp;Shalja Verma","doi":"10.1002/acg2.107","DOIUrl":"10.1002/acg2.107","url":null,"abstract":"<p>Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5′ end, which is added to all subgenomic mRNAs at their 5′ terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in-silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed-duplex stability, exact complementarity with target, at least three mismatches with any off-target and least number of off-targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5′GUUUAGAGAACAGAUCUACAA3′ met almost all specificity criteria with no off-targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of −327.45 for above-mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off-target sequences gave significantly low binding scores. Hence, 5′GUUUAGAGAACAGAUCUACAA3′ siRNA possess great potential to silence the leader sequence of SARS-CoV-2 with least off-target effect. Present study provides great scope for development of gene therapy against the prevailing COVID-19 disease, thus further research in this concern is urgently demanded.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-02-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.107","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"25533572","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Myeloablative haploidentical t-cell replete hematopoietic cell transplantation with post-transplant cyclophosphamide in high-risk hematological malignancies: Bending the learning curve in a middle-income setting","authors":"Sanket P. Shah,&nbsp;Vivek S. Radhakrishnan,&nbsp;Ganesh S. Jaishetwar,&nbsp;Reghu K. Sukumaran,&nbsp;Jeevan Kumar,&nbsp;Saurabh J. Bhave,&nbsp;Mita Roychowdhury,&nbsp;Sayak Chaudhuri,&nbsp;Deepak K. Mishra,&nbsp;Reena Nair,&nbsp;Shekhar Krishnan,&nbsp;Mammen Chandy","doi":"10.1002/acg2.106","DOIUrl":"10.1002/acg2.106","url":null,"abstract":"<p>Haploidentical peripheral blood hematopoietic cell transplantation has become the preferred alternative donor transplant program in most centers in India, owing to its logistic and cost advantages. This is a retrospective analysis of 59 patients with high-risk hematological malignancies who underwent haploidentical transplant in three different centers, using myeloablative conditioning and unmanipulated stem cell graft. GVHD prophylaxis was post-transplant Cyclophosphamide (PTCy D + 3, D + 4) along with Tacrolimus and Mycophenolate Mofetil (D + 5 onwards). The median CD34 cell dose was 5.8 x 10⁶ cells/kg. Neutrophils engrafted in 50 (83%) patients [median time D + 16 (range: 12-38)] and platelets engrafted in 42 patients (70%) [median time D + 17 (range: 12-50)]. Acute GVHD developed in 25 (41.7%) patients [Gr III/IV in 9] and Chronic GVHD in 15 (38.5%). 100-day mortality was 33.8%. With a median follow-up duration of 6.2 months (range: 0.4-50.8 months), the relapse rate, treatment-related mortality (TRM), and estimated 4-year overall survival are 10.0%, 43.3%, and 38.0%, respectively. For the 31 deaths: causes included engraftment failure (n = 7), GVHD (n = 7), persistent disease (n = 1), relapsed disease (n = 5), bacterial sepsis (n = 5), viral pneumonia (n = 1), infection (n = 3), secondary graft failure (n = 2). TRM outcomes have reduced over time with experience. Myeloablative conditioning and haploidentical transplantation by a post-transplant cyclophosphamide approach is feasible in a resource-constrained setting, despite higher rates of GVHD and infection-related mortality.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-12-27","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.106","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"44732953","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"CD276 as a novel CAR NK-92 therapeutic target for neuroblastoma","authors":"Stefan Grote,&nbsp;Kenneth Chun-Ho Chan,&nbsp;Caroline Baden,&nbsp;Hans Bösmüller,&nbsp;Mihály Sulyok,&nbsp;Leonie Frauenfeld,&nbsp;Martin Ebinger,&nbsp;Rupert Handgretinger,&nbsp;Sabine Schleicher","doi":"10.1002/acg2.105","DOIUrl":"10.1002/acg2.105","url":null,"abstract":"<p>Despite advanced understanding of its biology and improvements in standard of care treatment, the outcome for children with neuroblastoma (NB), the most common solid extracranial tumor in pediatrics, remains poor. Particularly, frequent relapse and high mortality rates of high-risk NB patients necessitate new therapeutic approaches such as chimeric antigen receptor (CAR)-modified immune cells. CAR T cells recently showed incredible clinical response targeting CD19 and CD22 in hematological malignancies. However, targeting solid cancers remains a difficult challenge and production of autologous CAR T-cell products still requires an extensive manufacturing process. The well-established natural killer (NK)-92 cell line provides a promising alternative to produce “off-the-shelf” CAR-modified effector cells. In the present study, we demonstrate that the immune checkpoint molecule B7-H3 (CD276) is aberrantly expressed on NB cells. Second generation CD276-CAR-engineered but not parental NK-92 cells were capable of specific and long-term elimination of NB cells in vitro while sparing CD276-negative cancer cells. Furthermore, CD276-CAR NK-92 cells showed increased cytotoxicity in a three-dimensional NB spheroid model which can recapitulate in vivo morphology as well as cell connectivity, polarity, gene expression, and tissue architecture, thereby, bridging the gap between in vitro and in vivo models. CD276-CAR NK-92 cells produced a multitude of NK effector molecules as well as pro-inflammatory cytokines that can stimulate the immune system. CD276-CAR surface expression and cytotoxic effector function remained stable for more than 6 months. Data show that CD276-CAR NK-92 may be a promising treatment option for patients with high-risk NB.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-10-19","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.105","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"42059101","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Prolonged neurotoxicity in a lymphoma patient after CD19-directed CAR T-cell therapy: A case report and brief review of the literature","authors":"Uri Greenbaum,&nbsp;Jeremy L. Ramdial,&nbsp;Amanda Olson,&nbsp;Yago Nieto,&nbsp;Paolo Strati,&nbsp;Sairah Ahmed,&nbsp;Sattva S. Neelapu,&nbsp;Sudhakar Tummala,&nbsp;Linda Chi,&nbsp;Elizabeth J. Shpall,&nbsp;Partow Kebriaei","doi":"10.1002/acg2.104","DOIUrl":"10.1002/acg2.104","url":null,"abstract":"<p>As the field of cancer therapeutics moves increasingly toward targeted and cellular therapies, this evolution comes with new hurdles. Toxicity of these therapies can result in serious adverse events that can become life-threatening. In particular, cytokine release syndrome (CRS) and immune effector cell-associated neurotoxicity syndrome (ICANS) are now the most common adverse effects resulting from chimeric antigen receptor (CAR) T-cell therapy. Furthermore, CAR T cells are reported to cause hyperactivation of macrophages, which in extreme cases results in hemophagocytic lymphohistiocytosis (HLH). These toxic effects result from cytokines released as a direct effect of the therapy. Physicians are evaluating inflammatory markers to monitor longitudinally cytokine stimulation and immune activation after therapy, which can help predict and gauge the severity of the cytokine storm. Prompt recognition of toxic effects and rapid intervention are essential in the management of patients receiving CAR T-cell therapy. Despite intervention, some patients still experience severe and prolonged ICANS. Herein we present a patient with lymphoma who developed prolonged ICANS and reviewed the literature on neurotoxicity and macrophage activation resulting from CD19-directed CAR T-cell therapy.</p>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-10-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.104","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"42803058","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Combining the disease risk index and hematopoietic cell transplant co-morbidity index provides a comprehensive prognostic model for CD34+-selected allogeneic transplantation","authors":"Christina Cho,&nbsp;Patrick Hilden,&nbsp;Scott T. Avecilla,&nbsp;Juliet N. Barker,&nbsp;Hugo Castro-Malaspina,&nbsp;Sergio A. Giralt,&nbsp;Boglarka Gyurkocza,&nbsp;Ann A. Jakubowski,&nbsp;Molly A. Maloy,&nbsp;Richard J. O’Reilly,&nbsp;Esperanza B. Papadopoulos,&nbsp;Jonathan U. Peled,&nbsp;Doris M. Ponce,&nbsp;Brian Shaffer,&nbsp;Roni Tamari,&nbsp;Marcel R. M. van den Brink,&nbsp;James W. Young,&nbsp;Pere Barba,&nbsp;Miguel-Angel Perales","doi":"10.1002/acg2.103","DOIUrl":"https://doi.org/10.1002/acg2.103","url":null,"abstract":"<div>\u0000 \u0000 \u0000 <section>\u0000 \u0000 <p>T cell depletion by CD34⁺ cell selection of hematopoietic stem cell allografts ex vivo reduces the incidence and severity of GvHD, without increased risk of relapse in patients with acute leukemia in remission or MDS. The optimal candidate for CD34⁺-selected HCT remains unknown, however.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Objective</h3>\u0000 \u0000 <p>To determine outcomes based on both disease- and patient-specific factors, we evaluated a prognostic model combining the Disease Risk Index (DRI) and Hematopoietic Cell Transplantation Comorbidity Index (HCT-CI), an approach recently shown to predict overall survival in a broad population of allograft recipients (Kongtim P, Parmar S, Milton DR, et al. Impact of a novel prognostic model, hematopoietic cell transplant-composite risk (HCT-CR), on allogeneic transplant outcomes in patients with acute myeloid leukemia and myelodysplastic syndrome. <i>Bone Marrow Transplant</i>. 2019;54(6):839-48).</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Methods</h3>\u0000 \u0000 <p>This was a retrospective analysis of 506 adult recipients of first allogeneic HCT with CD34 + selected PBSCs from 7/8- or 8/8-matched donors for AML (n = 290), ALL (n = 72), or MDS (n = 144). The Kaplan-Meier method estimated OS and RFS. The cumulative incidence method for competing risks estimated relapse and non-relapse mortality (NRM). We evaluated the univariate association between variables of interest and OS and RFS using the log-rank test. Cox regression models assessed the adjusted effect of covariates on OS/RFS.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Results</h3>\u0000 \u0000 <p>Stratification of patients based on a composite of DRI (low/intermediate vs high/very high) and HCT-CI (0-2 vs ≥3) revealed differences in OS and RFS between the four groups. Compared with reference groups of patients with low/intermediate DRI and low or high HCT-CI, those with high DRI had a greater risk of death (HR 2.30; 95% CI 1.39, 3.81) and relapse or death (HR 2.50; 95% CI 1.55, 4.05) than patients with any HCT-CI but low/intermediate DRI (HR death 1.80; 95% CI 1.34, 2.43; HR relapse/death 1.68; 95% CI 1.26, 2.24).</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Conclusions and Clinical Implications</h3>\u0000 \u0000 <p>A model combining DRI and HCT-CI predicted survival after CD34⁺ cell-selected HCT. Application of this combined model to other cohorts, both in retrospective analyses and prospective trials, will enhance clinical decision making and patient selection for different transplant approaches.</p>\u0000 </section>\u0000 </div>","PeriodicalId":72084,"journal":{"name":"Advances in cell and gene therapy","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-09-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://sci-hub-pdf.com/10.1002/acg2.103","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"71980925","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}