Molecular Vision最新文献

{"title":"Changes in glutamate and glutamine distributions in the retinas of cystine/glutamate antiporter knockout mice.","authors":"Luis J Knight, Renita M Martis, Paul J Donaldson, Monica L Acosta, Julie C Lim","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The cystine/glutamate antiporter is involved in the export of intracellular glutamate in exchange for extracellular cystine. Glutamate is the main neurotransmitter in the retina and plays a key metabolic role as a major anaplerotic substrate in the tricarboxylic acid cycle to generate adenosine triphosphate (ATP). In addition, glutamate is also involved in the outer plexiform glutamate-glutamine cycle, which links photoreceptors and supporting Müller cells and assists in maintaining photoreceptor neurotransmitter supply. In this study, we investigated the role of xCT, the light chain subunit responsible for antiporter function, in glutamate pathways in the mouse retina using an xCT knockout mouse. As xCT is a glutamate exporter, we hypothesized that loss of xCT function may influence the presynaptic metabolism of photoreceptors and postsynaptic levels of glutamate.</p><p><strong>Methods: </strong>Retinas of C57BL/6J wild-type (WT) and xCT knockout (KO) mice of either sex were analyzed from 6 weeks to 12 months of age. Biochemical assays were used to determine the effect of loss of xCT on glycolysis and energy metabolism by measuring lactate dehydrogenase activity and ATP levels. Next, biochemical assays were used to measure whole-tissue glutamate and glutamine levels, while silver-intensified immunogold labeling was performed on 6-week and 9-month-old retinas to visualize and quantify the distribution of glutamate, glutamine, and related neurochemical substrates gamma-aminobutyric acid (GABA) and glycine in the different layers of the retina.</p><p><strong>Results: </strong>Biochemical analysis revealed that loss of xCT function did not alter the lactate dehydrogenase activity, ATP levels, or glutamate and glutamine contents in whole retinas in any age group. However, at 6 weeks of age, the xCT KO retinas revealed altered glutamate distribution compared with the age-matched WT retinas, with accumulation of glutamate in the photoreceptors and outer plexiform layer. In addition, at 6 weeks and 9 months of age, the xCT KO retinas also showed altered glutamine distribution compared with the WT retinas, with glutamine labeling significantly decreased in Müller cell bodies. No significant difference in GABA or glycine distribution were found between the WT and xCT KO retinas at 6 weeks or 9 months of age.</p><p><strong>Conclusion: </strong>Loss of xCT function results in glutamate metabolic disruption through the accumulation of glutamate in photoreceptors and a reduced uptake of glutamate by Müller cells, which in turn decreases glutamine production. These findings support the idea that xCT plays a role in the presynaptic metabolism of photoreceptors and postsynaptic levels of glutamate and derived neurotransmitters in the retina.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"274-288"},"PeriodicalIF":2.2,"publicationDate":"2023-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784226/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466085","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Evaluation of the effects of latanoprost and benzalkonium chloride on the cell viability and nonpolar lipid profile produced by human meibomian gland epithelial cells in culture.","authors":"Jillian F Ziemanski, Landon Wilson, Stephen Barnes, Kelly K Nichols","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The purpose of this study was to explore the effects of a PGF_2α analog, latanoprost, and its preservative, benzalkonium chloride (BAK), on the cell viability and lipidomic expression of immortalized human meibomian gland epithelial cells (HMGECs).</p><p><strong>Methods: </strong>Differentiated HMGECs were exposed to latanoprost (0.05 to 50 µg/ml), BAK (0.2 to 200 µg/ml), or combined latanoprost-BAK (0.05-0.2 to 50-200 µg/ml). EP- and FP-type receptors, the cognate receptors of PGE₂ and PGF_2α, were inhibited, thereby sparing and isolating the function of each receptor to one condition. Cell viability was assessed by ATP quantitation, and lipid extracts were analyzed by ESI-MSMS^ALL with a Triple TOF 5600 Mass Spectrometer (SCIEX, Framingham, MA) using SCIEX LipidView 1.3.</p><p><strong>Results: </strong>Latanoprost and BAK were found to be lethal to HMGECs at the highest concentrations (p < 0.001 for both). The cytotoxicity of latanoprost was mediated through FP- and EP-independent mechanisms. Both latanoprost and BAK significantly modulated the lipidomic expression of several cholesteryl esters (8% and 30%, respectively) and triacylglycerols (10% and 12%, respectively). The combined latanoprost-BAK agent appeared to be no more toxic and to only negligibly alter the lipid profile relative to its individual components.</p><p><strong>Conclusions: </strong>The use of latanoprost and BAK in glaucoma may alter the viability of the meibomian glands and their lipid expression in vivo. Sublethal concentrations of BAK appear to modulate meibum lipid expression, particularly in relation to sterol biosynthesis. Non-preserved latanoprost had less cytotoxicity at lower doses and fewer lipidomic effects compared to BAK, further strengthening the argument in favor of BAK-free pharmaceutical preparations.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"289-305"},"PeriodicalIF":1.8,"publicationDate":"2023-11-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10805331/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139542357","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Outdoor time influences VIPR2 polymorphism rs2071623 to regulate axial length in Han Chinese children.","authors":"Xi He, Caixia Lin, Fengchuan Zhang, Sanguo Zhang, Mengtian Kang, Shifei Wei, He Li, Ningli Wang, Shi-Ming Li","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Clinical relevance: </strong>Identification of individuals with a higher risk of developing refractive error under specific gene and environmental backgrounds, especially myopia, could enable more personalized myopic control advice for patients.</p><p><strong>Background: </strong>Refractive error is a common disease that affects visual quality and ocular health worldwide. Its mechanisms have not been elaborated, although both genes and the environment are known to contribute to the process. Interactions between genes and the environment have been shown to exert effects on the onset of refractive error, especially myopia. Axial length elongation is the main characteristic of myopia development and could indicate the severity of myopia. Thus, the purpose of the study was to investigate the interaction between environmental factors and genetic markers of VIPR2 and their impact on spherical equivalence and axial length in a population of Han Chinese children.</p><p><strong>Methods: </strong>A total of 1825 children aged 13~15 years in the Anyang Childhood Eye Study (ACES) were measured for cycloplegic autorefraction, axial length, and height. Saliva DNA was extracted for genotyping three single-nucleotide polymorphisms (SNPs) in the candidate gene (VIPR2). The median outdoor time (2 h/day) was used to categorize children into high and low exposure groups, respectively. Genetic quality control and linear and logistic regressions were performed. Generalized multifactor dimensional reduction (GMDR) was used to investigate gene-environment interactions.</p><p><strong>Results: </strong>There were 1391 children who passed genetic quality control. Rs2071623 of VIPR2 was associated with axial length (T allele, β=-0.11 se=0.04 p=0.006), while SNP nominally interacted with outdoor time (T allele, β=-0.17 se=0.08 p=0.029). Rs2071623 in children with high outdoor exposure had a significant interaction effect on axial length (p=0.0007, β=-0.19 se=0.056) compared to children with low outdoor exposure. GMDR further suggested the existence of an interaction effect between outdoor time and rs2071623.</p><p><strong>Conclusions: </strong>Rs2071623 within VIPR2 could interact with outdoor time in Han Chinese children. More outdoor exposure could enhance the protective effect of the T allele on axial elongation.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"266-273"},"PeriodicalIF":2.2,"publicationDate":"2023-11-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784227/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466371","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Investigation of the antioxidant effect of Chrysin in an experimental cataract model created in chick embryos.","authors":"Gülan Albaş Kurt, Tolga Ertekin, Emre Atay, Abdülkadir Bilir, Halit Buğra Koca, Esra Aslan, Alperen Sarıtaş","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Cataract, which occurs as a result of lens opacification, is one of the most common causes of vision loss. In the literature, deterioration of the antioxidant system due to the increase in reactive oxygen species and oxidant levels is shown among the causes of cataract formation. The aim of this study was to investigate the antioxidant effect of chrysin on steroid-induced cataract development in an experimental chick embryo model using morphological, histological and biochemical parameters.</p><p><strong>Methods: </strong>Within the scope of the study, 150 specific pathogen free (SPF) fertilized eggs were used. Eggs were divided into 6 groups as control (group 1), corn oil (group 2), hydrocortisone hemisuccinate sodium (HC) (group 3), low dose chrysin (group 4), medium dose chrysin (group 5) and high dose chrysin (group 6). On the 15th day of incubation, Chrysin and HC were applicated to the air sac of the eggs with Hamilton and/or insulin injector. On day 17, the chick embryos were removed from the eggs and the bulbus oculi of the embryos were dissected. Lenses of 9 embryos were used for morpholigical cataract grading in each group, lens of 8 embryos for biochemical analysis and intact eyes of 7 embryos for histological evaluation (TUNEL method).</p><p><strong>Results: </strong>No opacity was observed in any of the lenses in Group 1 and 2. Cataract was observed in all lenses in Group 3. The mean opacity grades in group 3 were statistically significantly higher when compared to group 1 and 2 (p<0.05). The difference between group 6 and group 3 was statistically significant (p<0.05). GSH and TAS levels in the lenses were statistically significantly decreased compared to the control group due to HC application (p<0.05). It was determined that the decreased GSH and TAS levels in the lenses increased in relation to the Chrysin application doses. The increased levels of MDA, TOS, caspase 3 and caspase 9 in the HC group decreased significantly depending to the chrysin doses (p<0.05). In addition, while the rate of apoptotic cells determined by the TUNEL method was statistically significantly higher in the HC administered group than in the control group (p<0.05), it was statistically significantly decreased in the chrysin-administered groups, in relation to the dose of chrysin (p<0.05).</p><p><strong>Conclusions: </strong>We think that anti-cataract effect of crhysin may be due to the antioxidant and antiapoptotic properties of chrysin. However, more research is needed to clarify the anti-cataract effects of chrysin.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"245-255"},"PeriodicalIF":2.2,"publicationDate":"2023-11-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784222/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466274","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Evaluation of the Algerbrush II rotating burr as a tool for inducing ocular surface failure in a mouse model.","authors":"Athar Shadmani, Trent Jarin, Xiang Qi Meng, Yugendran Rajaendran, Salih Uzun, Albert Y Wu","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The Algerbrush II has been widely used to induce corneal and limbal injuries in animal models. The extent of injury varies with the duration of exposure, pressure from the placement of the burr, and the size of the burr. However, no study has explored the correlation between the duration of exposure and the severity of injury in mouse model with corneal and limbal stem cell deficiency (LSCD) induced using the Algerbrush II. Therefore, this study aimed to evaluate the variations in the severity of corneal and limbal injury with different durations of the Algerbrush II application.</p><p><strong>Methods: </strong>The entire cornea and limbus of C57BL/6 mice were injured for 30-45 s, 60-75 s, 90-120 s, and 3-4 min. Photography and slit-lamp examination was performed on days 0, 2, 4, and 7, followed by hematoxylin & eosin, periodic acid-Schiff, and immunohistochemical staining. Statistical analysis was performed using one way ANOVA analysis.</p><p><strong>Results: </strong>A duration of 30-45 s of injury was found to be sufficient to induce superficial corneal and limbal epithelial debridement and re-epithelialization was completed in all eyes by day 7; however, clinical signs of LSCD were not observed in all mice. Increasing the exposure time to 90-120 s resulted in central 2+ corneal opacity with limbal and paracentral corneal neovascularization. All eyes injured for 3-4 min displayed clinical signs of LSCD, such as persistent epithelial defects on day 7 after the injury, central corneal neovascularization, and 2.2+ diffuse corneal opacity. Histological signs of LSCD, including goblet cell metaplasia and K13 expression on the corneal surface, were observed in all injured eyes.</p><p><strong>Conclusions: </strong>Our findings suggest that the duration of injury is an important factor influencing the severity of LSCD in a murine model of injury. A 1-mm rotating burr was found to be more effective for keratectomy and pigment release, whereas a 0.5-mm burr was more suitable for corneal epithelial debridement.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"256-265"},"PeriodicalIF":2.2,"publicationDate":"2023-11-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784216/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466190","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"<i>GPR143</i> mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.","authors":"Jingling Xu, Yihan Zheng, Lulu Cheng, Huihui Sun, Xinping Yu, Feng Gu, E Song","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. <i>GPR143</i> is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.</p><p><strong>Methods: </strong>A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of <i>GPR143</i>. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.</p><p><strong>Results: </strong>Genetic analysis identified 11 <i>GPR143</i> mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a <i>GPR143</i> mutation were found to present a typical or atypical phenotype of OA1. All patients with <i>GPR143</i> mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.</p><p><strong>Conclusions: </strong>We discovered seven novel mutations and four previously reported mutations of <i>GPR143</i> in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"234-244"},"PeriodicalIF":2.2,"publicationDate":"2023-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784212/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139465935","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Protein modeling and in silico analysis to assess pathogenicity of <i>ABCA4</i> variants in patients with inherited retinal disease.","authors":"Senem Cevik, Nutsuchar Wangtiraumnuay, Kristof Van Schelvergem, Mai Tsukikawa, Jenina Capasso, Subhasis B Biswas, Barry Bodt, Alex V Levin, Esther Biswas-Fiss","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>The retina-specific ABCA transporter, ABCA4, plays an essential role in translocating retinoids required by the visual cycle. <i>ABCA4</i> genetic variants are known to cause a wide range of inherited retinal disorders, including Stargardt disease and cone-rod dystrophy. More than 1,400 <i>ABCA4</i> missense variants have been identified; however, more than half of these remain variants of uncertain significance (VUS). The purpose of this study was to employ a predictive strategy to assess the pathogenicity of <i>ABCA4</i> variants in inherited retinal diseases using protein modeling and computational approaches.</p><p><strong>Methods: </strong>We studied 13 clinically well-defined patients with <i>ABCA4</i> retinopathies and identified the presence of 10 missense variants, including one novel variant in the <i>ABCA4</i> gene, by next-generation sequencing (NGS). All variants were structurally analyzed using AlphaFold2 models and existing experimental structures of human ABCA4 protein. The results of these analyses were compared with patient clinical presentations to test the effectiveness of the methods employed in predicting variant pathogenicity.</p><p><strong>Results: </strong>We conducted a phenotype-genotype comparison of 13 genetically and phenotypically well-defined retinal disease patients. The in silico protein structure analyses we employed successfully detected the deleterious effect of missense variants found in this affected patient cohort. Our study provides American College of Medical Genetics and Genomics (ACMG)-defined supporting evidence of the pathogenicity of nine missense <i>ABCA4</i> variants, aligning with the observed clinical phenotypes in this cohort.</p><p><strong>Conclusions: </strong>In this report, we describe a systematic approach to predicting the pathogenicity of <i>ABCA4</i> variants by means of three-dimensional (3D) protein modeling and in silico structure analysis. Our results demonstrate concordance between disease severity and structural changes in protein models induced by genetic variations. Furthermore, the present study suggests that in silico protein structure analysis can be used as a predictor of pathogenicity and may facilitate the assessment of genetic VUS.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"217-233"},"PeriodicalIF":2.2,"publicationDate":"2023-10-25","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784225/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466381","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Oxidative stress-induced temporal activation of ERK1/2 phosphorylates coreceptor of Wnt/β-catenin for myofibroblast formation in human lens epithelial cells.","authors":"Zaoxia Guo, Xiaopan Ma, Xi Chen, Rui Xue Zhang, Hong Yan","doi":"","DOIUrl":"","url":null,"abstract":"&lt;p&gt;&lt;strong&gt;Purpose: &lt;/strong&gt;Posterior capsular opacification (PCO) is the most common complication postcataract surgery, and its underlying mechanisms involve epithelial-mesenchymal transition (EMT) of remnant lens epithelial cells (LECs) in response to drastic changes in stimuli in the intraocular environment, such as oxidative stress and growth factors. Wnt/β-catenin signaling is a major pathway mediating oxidative stress-induced EMT in LECs, but its interplay with other transduction pathways remains little known in the development of PCO. ERK1/2 signaling is the downstream component of a phosphorelay pathway in response to extracellular stimuli (e.g., reactive oxygen species), and its activation regulates multiple cellular processes, including proliferation and EMT. Thus, this study aimed to investigate how ERK1/2 signaling and Wnt/β-catenin pathway crosstalk in oxidative stress-induced EMT in LECs.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Methods: &lt;/strong&gt;Hydrogen peroxide (H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt;) at 50 μM treatment for 48 h was used to establish a moderate oxidative stress-induced EMT model in LECs. ERK1/2 signaling was inhibited using MEK1/2 inhibitor U0126 at 20 μM. Western blotting was used to quantify protein expression of various biomarkers of EMT and phosphorylated components in ERK1/2 and Wnt/β-catenin signaling. LEC proliferation was determined using an EdU staining assay and expression of proliferating cellular nuclear antigen (PCNA). Subcellular localization of biomarker proteins was visualized with immunofluorescent staining.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Results: &lt;/strong&gt;Under the moderate level of H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt;-induced EMT in LECs, ERK1/2 signaling was activated, as evidenced by a marked increase in the ratio of phosphorylated ERK1/2 to total ERK1/2 at early (i.e., 5-15 min) and late time points (i.e., 12 h); the canonical Wnt/β-catenin pathway was activated by H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt; at 48 h. LECs exposed to H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt; exhibited hyperproliferation and EMT; however, these were restored by inhibition of ERK1/2 signaling demonstrated by reduced DNA synthesis and PCNA expression for cellular proliferation and altered expression of various EMT protein markers, including E-cadherin, α-SMA, and vimentin. More importantly, inhibition of ERK1/2 signaling reduced β-catenin accumulation in the activated Wnt/β-catenin signaling cascade. Specifically, there was significant downregulation in the phosphorylation level of LRP6 at Ser 1490 and GSK-3β at Ser 9, the key coreceptor of Wnt and regulator of β-catenin, respectively.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Conclusions: &lt;/strong&gt;ERK1/2 signaling plays a crucial role in the moderate level of oxidative stress-induced EMT in LECs. Pharmacologically blocking ERK1/2 signaling significantly inhibited LEC proliferation and EMT. Mechanistically, ERK1/2 signaling regulated Wnt/β-catenin cascade by phosphorylating Wnt coreceptor LRP6 at Ser 1490 in the plasma membrane. These results shed light on a potential molecular switch","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"206-216"},"PeriodicalIF":2.2,"publicationDate":"2023-10-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784218/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466374","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Addressing bias in manual segmentation of spheroid sprouting assays with U-Net.","authors":"Julian Rapp, Daniel Böhringer, Günther Schlunck, Hansjürgen Agostini, Thomas Reinhard, Felicitas Bucher","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Angiogenesis research faces the issue of false-positive findings due to the manual analysis pipelines involved in many assays. For example, the spheroid sprouting assay, one of the most prominent in vitro angiogenesis models, is commonly based on manual segmentation of sprouts. In this study, we propose a method for mitigating subconscious or fraudulent bias caused by manual segmentation. This approach involves training a U-Net model on manual segmentations and using the readout of this U-Net model instead of the potentially biased original segmentations. Our hypothesis is that U-Net will mitigate any bias in the manual segmentations because this will impose only random noise during model training. We assessed this idea using a simulation study.</p><p><strong>Methods: </strong>The training data comprised 1531 phase contrast images and manual segmentations from various spheroid sprouting assays. We randomly divided the images 1:1 into two groups: a fictitious intervention group and a control group. Bias was simulated exclusively in the intervention group. We simulated two adversarial scenarios: 1) removal of a single randomly selected sprout and 2) systematic shortening of all sprouts. For both scenarios, we compared the original segmentation, adversarial segmentation, and respective U-Net readouts. In the second step, we assessed the sensitivity of this approach to detect a true positive effect. We sampled multiple treatment and control groups with decreasing treatment effects based on unbiased ground truth segmentation.</p><p><strong>Results: </strong>This approach was able to mitigate bias in both adversarial scenarios. However, in both scenarios, U-Net detected the real treatment effects based on a comparison to the ground truth.</p><p><strong>Conclusions: </strong>This method may prove useful for verifying positive findings in angiogenesis experiments with a manual analysis pipeline when full investigator masking has been neglected or is not feasible.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"197-205"},"PeriodicalIF":2.2,"publicationDate":"2023-10-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784213/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466074","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Light damage induces inflammatory factors in mouse retina and vitreous humor.","authors":"Wei Liu, Xingfei Zhu, Xiangyu Ge, Yulin Chen, David Wan-Cheng Li, Lili Gong","doi":"","DOIUrl":"","url":null,"abstract":"<p><strong>Purpose: </strong>Increased inflammatory factor levels have been reported in the vitreous humor (VH) of diabetic retinopathy and neovascular age-related macular degeneration, ocular diseases generally associated with the formation of new retinal blood vessels and leakage. However, the levels of inflammatory mediators are less known in retinal degeneration without neovascularization. Human retinitis pigmentosa (RP) and animal models of light-induced retinal degeneration (LIRD) share several features, such as photoreceptor death and retinal inflammation. Here, we aimed to determine the levels of inflammatory factors in the VH of the LIRD mouse model.</p><p><strong>Methods: </strong>LIRD was induced by exposing BALB/c mice to white light (15,000 lx, 2 h), and the mice were recovered for 2 days before analysis (n = 50 mice). We assessed retinal morphology using optical coherence tomography and hematoxylin and eosin staining; retinal cell viability was determined using terminal deoxynucleotidyl transferase dUTP nick-end labeling, and retinal responses were measured based on electroretinogram signals. Total retinal RNAs were extracted and subjected to RNA sequencing analysis. VH samples from control (n = 4) and LIRD mice (n = 9) were assayed in triplicate for a panel of four inflammatory mediators using the Simple Plex Cartridge on an Ella System.</p><p><strong>Results: </strong>Retinal degeneration, photoreceptor death, infiltration of microglia/macrophages into the photoreceptor layer, and loss of a- and b-waves were obviously detected after LIRD. RNA sequencing revealed that light damage (LD) led to the significant upregulation of inflammatory factors in mouse retinas. In the VH, LD increased the total protein concentration. Dramatic induction of CCL2 (~3000 fold) and IL6 (~10 fold) was detected in VH in response to LD. Increased but not significant levels of TNFα and IL1β were also detected in light-exposed VH.</p><p><strong>Conclusions: </strong>Given that the LIRD model mimics RP pathogenesis in some aspects, these results suggest a causative link between retinal degeneration and VH inflammation in RP progression, and the increased CCL2 level in VH may reflect similar elevated CCL2 expression in the degenerative retina.</p>","PeriodicalId":18866,"journal":{"name":"Molecular Vision","volume":"29 ","pages":"180-187"},"PeriodicalIF":2.2,"publicationDate":"2023-10-15","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10784230/pdf/","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139466222","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}