{"title":"A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia","authors":"Nooratiny, I, K. Krishnan","doi":"10.47253/jtrss.v10i1.897","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.897","url":null,"abstract":"A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCAGAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to , R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84282376","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
N. N. A. Zakaria, Azrina Zolkopli Mohamad, Zuhar Zahir Tuan Harith, Nurhanan Abdul Rahman, Mohamad Feizal Daud
{"title":"Antioxidant and antibacterial activities of red (Hylocereus polyrhizus) and white (Hylocereus undatus) dragon fruits","authors":"N. N. A. Zakaria, Azrina Zolkopli Mohamad, Zuhar Zahir Tuan Harith, Nurhanan Abdul Rahman, Mohamad Feizal Daud","doi":"10.47253/jtrss.v10i1.892","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.892","url":null,"abstract":"Dragon fruit belongs to the genus Hylocereus of the Cactaceae family. There are two species that are commonly cultivated; Hylocerues polyrhizus and Hylocereus undatus that have the same red skin but different flesh colours, red and white respectively. Although from the same genus, the phytochemical contents and bioactivities of both fruits may not be the same. This study aims to compare the phytochemical contents, antioxidant and antibacterial activities of H. polyrhizus and H. undatus to help consumers better choose nutritional fruits and to explore potential natural preservatives. The fruit samples were extracted using 50% ethanol and later were subjected to phytochemical, antioxidant and antibacterial assays. The phytochemical contents were determined using Folin Ciolcalteu and aluminium chloride methods for total phenolic and total flavonoid respectively. The antioxidant activity was determined using diphenyl-picryl hydrazine (DPPH) and 2,2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) assays. Disk diffusion method was performed to evaluate antibacterial activities against two food-borne pathogens, Escherichia coli and Staphylococcus aureus. H. polyrhizus showed to contain significantly higher phenolic content (p<0.05), while H. undatus had significantly higher flavonoid content (p<0.05). Comparison of antioxidant activities in both fruit samples indicated higher activities were observed in H. polyrhizus and both fruit extracts showed inhibition zones against the tested bacteria with H. polyrhizus extract was able to inhibit at lower concentration. The results suggest that H. polyrhizus may have higher bioactivities compared to H. undatus due to the significantly higher phenolic content.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84001737","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Munjira Yeasmin, Md. Abdur Rahman, Shaibur Rahman Molla
{"title":"The effect of drinking water sources due to Cyclone Aila at Shyamnagar, Sathkhira district, Bangladesh","authors":"Munjira Yeasmin, Md. Abdur Rahman, Shaibur Rahman Molla","doi":"10.47253/jtrss.v10i1.891","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.891","url":null,"abstract":"Bangladesh is the most vulnerable country to disaster and its impact. Coastal Bangladesh along with the Bay of Bengal is the most important and suffered group of cyclone impacts. Cyclone Aila hit the southwestern coast of Bangladesh on 25 May 2009. About two million people were affected and washed away a huge number of households, lives, livestock, crops, and all other resources of the affected area. Water resources in the coastal area are always a term of crisis and even the aila mostly damaged all the resources including surface or groundwater sources. This study focuses on the recovery status of the affected area with considering the drinking water sources. About 36 water samples had been collected for the experiment including rainwater harvesting (6), pond sand filters (6), protected pond (6), and hand tube well (6) from specific six unions of Shyamnagar Upazilla under Sathkhira District in between the time of August to October 2016. A questionnaire field survey was conducted in the most affected coastal area in Bangladesh where about 103 households (309 respondents) participated in their willingness and the study considering their frequency of loss. The results showed a huge dimension of the water crisis and its mitigation. Protected pond and tube well water exceeded the DoE standard for almost all chemical parameters except potassium (3.28 mg/L and 3.75 mg/L), sulfate (377.19 mg/L and 225.66 mg/L), chloride (365.05 mg/L and 349.10 mg/L) and arsenic (1.76±0.25 mg/L and 3.78±1.43). Pond sand filter (PSF) and rainwater harvesting (RWH) had shown the lowest amount of all chemical concentrations compared with another two sources. The respondents face the problem of the distance from the household and the yearly availability of drinking water. They demand monitoring and source management system improvement along with community-based resource management. From the aila event, a huge recovery application is implemented here but these are not sufficient. Respondents gave some opinions to solve this crisis. Considering all aspects, they need a low-cost and more efficient drinking water source to survive their situation.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87624485","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Mohamad Faris Saiman, N. Othman, Norazlina Abu Sari
{"title":"Influence of copper-zinc mixture in different rates on pH and electrical conductivity as a potential for foliar spray fertilization","authors":"Mohamad Faris Saiman, N. Othman, Norazlina Abu Sari","doi":"10.47253/jtrss.v10i1.898","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.898","url":null,"abstract":"Electrical conductivity (EC) and pH of a nutrient solution influences the availability of nutrients, so it should be maintained in the optimum range. Nutrient solutions available to plants at low pH (between 5.0 and 6.0) and EC (between 1.6 and 2.4). Pineapple plants require copper and zinc micronutrients to produce high quality fruits. By applying different rates of copper-zinc chelated fertilizer with NPK fertilizer, it will help to increase the plant growth and nutrient uptake. 0.1,0.2,0.3,0.4,0.5 and 0.6 g of copper EDTA and zinc EDTA were added with 8.89 g nitrogen, 3.86 g phosphorus, and 2.18 g potassium. All the mixtures were diluted with 250 ml water. Electrical conductivity (EC) analysis was measured using the EC meter with calibrated conductivity meter while pH solution was measured using pH meter. Results from this study can be concluded that there was a significant difference between pH and EC reading. The optimum solution at 0.6 g rate of copper EDTA and zinc EDTA showed pH 5.74 and EC reading at 1.156 ms/m. The findings of this study showed that copper-zinc chelated fertilizer mixtures at different rates can affect the reading of pH and EC.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"79175307","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Merrious Oviri Ofomola, Misan Tony Eyituoyo, Ochuko Anomohanran
{"title":"Mapping of aquifer hydraulic properties in Ogbeje and Umeghe in Abraka, Delta State Nigeria: insights from geophysical and hydrogeological methods","authors":"Merrious Oviri Ofomola, Misan Tony Eyituoyo, Ochuko Anomohanran","doi":"10.47253/jtrss.v10i1.896","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.896","url":null,"abstract":"Vertical Electrical Sounding (VES), Pumping test, well logging and grain size analysis were conducted with the aim of studying the subsurface geophysical formation in order to determine aquifer characteristics such as hydraulic conductivity, transmissivity and other parameters for groundwater exploration purposes around Ogbeje and Umeghe, Abraka Delta State. Nine (9) VES stations were occupied and the results obtained from the computer iterations suggest 4 to 5 geoelectric layers. The aquiferous layers wwerefound at a depth ranging from 20.0 m – 38.3 m with resistivity ranging from 2200 ?m to 8500 ?m and thickness varying between 6.7 and 20.0 m. The VES study reveals the possibility of having a maximum drill depth the o water table of about 38 m. The results obtained from the pumping test and well logginwereas used to estimate the transmissivity value of T = 0.0722 m2/min, storativity S = 0.00063, specific capacity of the well = 0.39 m2/min and hydraulic conductivity, K= 8.5 m/day while the result from the grain size analysis gave hydraulic conductivity as Kmin= 12.96 m/d to Kmax = 26.96 m/d respectively. Thus, these results indicate that the aquifer is capable of proda ucing sufficient amount of water for both domestic and industrial purposes for the people in the area. \u0000","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"80481098","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Assessing Growth Performance and Yield of Okra (Abelmoschus esculentus (L.) Moench) Using Slow-Release Fertilizer","authors":"Ayu Nazira Suhaimi, N. A. Abdul Latif, N. Md Zain","doi":"10.47253/jtrss.v10i1.889","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.889","url":null,"abstract":"The agricultural sector has contributed to environmental pollution, such as water and air pollution caused by the fertiliser used in agriculture is lost into the river or to the air through the leaching process. Studies in the literature have shown that slow-release fertiliser (SRF) application could help overcome the leaching problem as it releases its nutrients slower. In other words, SRF is expected to help maintain the nutrients' availability in the soil for a more extended period and extends the plants' nutrient uptake efficiency. The experimental design for this study was completely randomized design with 4 different treatments T0 (control) was treatment without fertilizer application; T1 (SRF applied once in a month); T2 (CF applied once in a month); T3 (SRF applied twice in a month) and T4 (CF applied twice in a month). This study aimed to compare the plant growth rate (plant height, number of leaves and plant yield) of using SRF and conventional fertiliser (CF) on okra (Abelmoschus esculentus L. Moench). This study shows that SRF does show a good option to promote the growth development of okra (plant height, number of leaves and chlorophyl content) but not on the yield.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77534033","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Faikah Awang @ Ismail, Muhammad Syukri Bin Razali Zuraimy Ali
{"title":"Total phenolic content (TPC) in Catharanthus roseus and Clitoria ternatea leaves extract","authors":"Faikah Awang @ Ismail, Muhammad Syukri Bin Razali Zuraimy Ali","doi":"10.47253/jtrss.v10i1.888","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.888","url":null,"abstract":"Catharanthus roseus or “Kemunting Cina” and Clitoria ternatea or “Bunga Telang\" had a long reputation as a traditional remedy in South East Asia. One of the important components that contribute to these plants' remedial capabilities is the secondary metabolic known as phenolic. In this study, the Total Phenolic Contents or TPC in Catharanthus roseus and Clitoria ternatea leaves extract have been obtained and compared. Leaves from both species were dried and the extract was acquired using 90% ethanol via a rotary evaporator. Two major tests were conducted which are the qualitative test and quantitative test. The qualitative test was done to ensure the existence of phenolic in the samples. Meanwhile, the quantitative test is to measure the concentration of phenolic in the samples. Both samples show a positive result in a qualitative test where the extract of the sample changed from green to dark green in the Ferric Chloride test. Next, Folin- Ciocalteu assay acted as the quantitative test to determine the TPC in the samples, and the absorbance was measured at 760 nm. The test was triplicated to ensure the consistency of the results. The total phenolic content for Catharanthus roseus is 36.33600 ± 0.935313mg/GAE and Clitoria ternatea is 7.35767 ± 0.046188mg/GAE. The TPC in Catharanthus roseus is higher than Clitoria ternatea. The t-test shows that there is a significant difference in concentration of total phenolic content between Catharanthus roseus and Clitoria ternatea (p","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"88519137","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Nur Syahirah Rosmadi, Nursufiah Sulaiman, N. Sulaiman, J. Asis
{"title":"Biostratigraphy and paleodepositional environment of the Temburong Formation at Batu Luang, Klias Peninsula, Sabah based on calcareous nannofossil.","authors":"Nur Syahirah Rosmadi, Nursufiah Sulaiman, N. Sulaiman, J. Asis","doi":"10.47253/jtrss.v10i1.894","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.894","url":null,"abstract":"Generally, the Temburong formation was observed for both research studies and hydrocarbon exploration. There was few research conducted on its lithostratigraphy and micropaleontological purposes in terms of research studies. However, there is no evidence suggested to observe the paleoenvironment condition of the formation based on the calcareous nannofossils occurrences. Therefore, this research was performed deliberately to identify paleoclimate prediction of Batu Luang, Klias Peninsular based on the assemblages of the calcareous nannofossils. 17 samples have been collected from a measuring section of a cutting hill along the road. Simple smear preparation was used and observed their assemblages were under the light microscope. As many as 27 species have been identified and dominantly preserved by discoasters and sphenolithus. Thus, this formation has been considered an oligotrophic condition and low latitude region due to the distribution of warm-water taxas. Plus, less contribution of cold-water taxa Coccolitus pelagicus to the formation is late Oligocene to early Miocene.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78991843","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Ahmad Hazim Arjonit, N. Othman, Irsyad Sulaimi Ramly, Nur Badriyah Kamaruzaman
{"title":"Comparison of fermented fruit juice as a carrier for isolation phosphate-solubilizing bacteria from rice root","authors":"Ahmad Hazim Arjonit, N. Othman, Irsyad Sulaimi Ramly, Nur Badriyah Kamaruzaman","doi":"10.47253/jtrss.v10i1.890","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.890","url":null,"abstract":"Fermented fruit juice is the material use to increase the soil microbial activity as it made up from fermented fruit in the container for a several time before it became a liquid compose fertilizer. It contains a lot of substances such as an organic compound which is one of the important nutrient source for bacteria in soil. By applying the fermented fruit juice (FFJ) in soil, it will help to increase the soil fertility itself. The aim of the present study is investigate the targeted soil bacteria which is phosphate-solubilizing bacteria inside the soil paddy root. This study was also revealed type of fruit that been used for fermented fruit juice namely corn cobs, coconut, and fruit waste. The statistical analysis has been conducted by using IBM SPSS version 2.0 for the bacteria population calculation. The findings of the present study showed there is significant different between the bacteria population among the treatments and fermented fruit juice can be used as carrier for phosphate solubilizing bacteria and one of the effective biofertilizer to increase soil fertility. \u0000","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78177024","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Physico-chemical properties and mineral content of Apis Mellifera L. honey samples sourced from different localities in Anambra and Enugu States, South-eastern, Nigeria","authors":"N. C. Ikegbunam, O. J. Walter","doi":"10.47253/jtrss.v9i2.790","DOIUrl":"https://doi.org/10.47253/jtrss.v9i2.790","url":null,"abstract":"Six honey samples were collected from various locations in Anambra and Enugu states in southeastern Nigeria and analyzed for physicochemical characteristics and mineral composition. pH, moisture, protein, fats, ash, polyphenol, free acidity, hydroxymethylfurfural (HMF), and sugar were among the physicochemical parameters studied. Minerals such as potassium, calcium, zinc, magnesium, sodium, cadmium, and lead were also investigated. The samples had pH values ranging from 4.00 - 4.40. Moisture content ranged from 8.95% - 14.30%, ash 0.21 - 0.54%, protein 0.21- 0.74%, fat 0.00 - 0.50%, polyphenol 2.75 - 12.00%; free acidity 33.60 - 89.890 meq kg-1 and HMF 18.70 - 75.43 mg/kg. The sugar assays revealed that all of the honey samples contained the appropriate quantity of sugar for acceptable quality honey, albeit there were substantial variances in the values recorded across the locations. The mineral composition revealed that potassium was the most abundant element, followed by zinc, calcium, magnesium, and sodium. In the samples, no cadmium or lead was found. The results of the evaluated honey samples revealed that the majority of the measured parameters recorded met international standards, indicating that they were safe for human consumption.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"85110791","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}