{"title":"Comparative efficacy of three synchronization protocols in anestrous goats (Capra hircus)","authors":"M. Shahzad, R. Kausar","doi":"10.47253/jtrss.v10i2.996","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.996","url":null,"abstract":"The goal of this experiment was to compare the effectiveness of three popular synchronization protocols, viz. ovsynch, double prostaglandin (PGF2? /PG) injections, and MAP (Medroxyprogesterone acetate) sponges, in anestrous goats. Twenty one non pregnant multiparous anestrous goats with an average body condition score (BCS = 2.5) were selected. After the last PG injection, all the goats were exposed to three fertile bucks. They were observed to be in standing estrus. For further confirmation of copulation, a vaginal cytology test was performed for the presence of sperm inside the vaginal smear. Serum estradiol (E2) peaks were also estimated by using radioimmunoassay in estrus goats. MAP sponge efficiency with respect to estrus induction was found to be superior (57%) as compared to the rest (Ovsynch14 and PG 0%) (p< 0.05). Post PG standing estrus time in ovsynch and MAP groups was recorded as 48 h and 44 ± 12 h, respectively. The double PG group totally failed to show standing estrus. E2 peak levels ranging from 11-38 pg/ml in ovsynch and 10–25 pg/ml in the MAP group were observed in estrus goats. This study found the MAP sponge protocol most efficient for inducing estrus in anestrous goats.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89834859","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Discovery of large mangrove-dwelling Elysia species in the newly-grown mangrove habitats, Pattani, Thailand","authors":"Somsak Buatip, Supaporn Saengkeaw, Supakan Buatip","doi":"10.47253/jtrss.v10i2.1002","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.1002","url":null,"abstract":"The first report on the occurrence of the remarkable and highly ephemeral sap-sucking sea slugs Elysia bangtawaensis and E. leucolegnote from the newly grown mangrove forest in the Prince of Songkla University, Pattani, Thailand. Elysia was surveyed by exploring from the inner part to the floor front zone of the mangrove area. The various sizes and numbers of E. bangtawaensis were clumped distribution in some microhabitats throughout the area, while E. leucolegnote was distributed in the floor front zone of the area. Both species have similar external morphological characters with conspecifics previously reported in Pattani Bay, Gulf of Thailand, Andaman Sea, and elsewhere. E. bangtawaensis showed a surprisingly larger size than previously reported. This discovery is important in identifying the changes in ecosystems within the area to support the diversity of organisms that will come to use the area in the future.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87687031","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
F. A. Abdullah, Mahazan Muhammad, Mohd Saifoul Zamzuri Noor, Syamsuriana Sidek, Tengku Halimatun Sa’adiah T. Abu Bakar, M. Jusoh
{"title":"Challenges faced by beef cattle farmers in innovation adoption towards food security and sustainability: a narrative review","authors":"F. A. Abdullah, Mahazan Muhammad, Mohd Saifoul Zamzuri Noor, Syamsuriana Sidek, Tengku Halimatun Sa’adiah T. Abu Bakar, M. Jusoh","doi":"10.47253/jtrss.v10i2.1004","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.1004","url":null,"abstract":"The agricultural industry in Malaysia remains a vital element in providing food and employment. Introducing innovation in beef cattle farming has brought new changes in the livestock sector. Hopefully, it can generate a high income among farmers and brighten the Malaysian economy. However, introducing innovations such as assisted reproduction technology, biosecurity and intensive rearing require more significant effort from all parties, including farmers, extension agents and the government. This paper aims to identify beef cattle farmers' challenges in adopting innovations to improve beef production. Process of identifying, screening and eligibility is essential in producing an extensive literature review paper. From these processes, nine articles were found as the most relevant for this review article. The financial problem, communication failure and inaccessible information were the main challenges faced by farmers and extension agents in implementing innovations. Nevertheless, cooperation from all parties can lead to an excellent distribution of knowledge and skills among farmers.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"73658312","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Murni Azureen Mohd Pakri, J. Arif Shah, Nur Bahiah Mohamed Haris, N. Mazlan
{"title":"Factors Influencing Farmers' Readiness to Face Covid-19 Post-Movement Control Order Challenges in Peninsular Malaysia","authors":"Murni Azureen Mohd Pakri, J. Arif Shah, Nur Bahiah Mohamed Haris, N. Mazlan","doi":"10.47253/jtrss.v10i2.1008","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.1008","url":null,"abstract":"The COVID-19 pandemic is a global health catastrophe that has had severe effects on the worldwide economy, both directly and indirectly, because of the spread of the virus. The food and agriculture industries are also experiencing the effects. The COVID-19 epidemic disrupted the regular delivery system of agricultural extension services and the delivery of agricultural produce to markets. The study aimed to determine farmers' readiness to address post-MCO challenges in technology, implementation, decision-making, and leadership. Following the COVID-19 rules of reducing close contact to minimize virus transmission, a structured questionnaire was delivered to farmers online (Google form) and face-to-face with the support of extension agents. The results show that the relationship between independent and dependent variables was positive. Also, according to the findings, decision-making is the most crucial element influencing farmers' readiness to tackle post-movement control order issues. According to researchers, farmers' abilities should be developed to overcome challenges in pandemic conditions.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"88597251","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Muhammad Redzwan Sidik, S. A. Shohaimi, Faizul Fikri Mohd Yusop, B. L. Leow, Mohd Khairil Azhar Md Haris, G. H. Ong, Maizatul Zaimi, Mohammad Jihan Redzuan
{"title":"Molecular detection of chicken astrovirus in broiler chicken, Malaysia","authors":"Muhammad Redzwan Sidik, S. A. Shohaimi, Faizul Fikri Mohd Yusop, B. L. Leow, Mohd Khairil Azhar Md Haris, G. H. Ong, Maizatul Zaimi, Mohammad Jihan Redzuan","doi":"10.47253/jtrss.v10i2.1001","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.1001","url":null,"abstract":"The emergence of avian diseases can cause major economic problems due to production losses and mortality in domestic poultry. Astrovirus is frequently associated with enteric diseases in poultry, being isolated from cases of runting-stunting syndrome (RSS) of broiler chickens, poult enteritis complex (PEC), and poult enteritis mortality syndrome (PEMS) of turkeys. Avian astrovirus can be detected in chickens from both healthy and poorly performing flocks. In Malaysia, information and reports regarding chicken astrovirus (CAstV) in poultry are limited. The objective of this study is to perform a phylogenetic study on the avian astrovirus isolated from a suspected case in 2019 and to determine the subgroups of avian astrovirus strains that existed in Malaysia. Reverse Transcription Polymerase chain reaction (RT-PCR) was performed based on the partial ORF1b gene and the nucleotide sequence was analyzed. Phylogenetic analysis showed that this isolate was clustered together with CAstV strains from several strain from USA, Malaysia and others. Furthermore, the isolate from broiler chicken showed 97.2% to 99.4% of its nucleotide identity with isolates from the American strains, compared to the previously CAstv Malaysia strain, which shared 94.8% to 95%.Therefore, the current study provides important information on the epidemiology of CAstV and highlights the importance of control strategies against CAstV-infected poultry in Malaysia.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89539174","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia","authors":"Kumara Thevan Krishnan, N. I","doi":"10.47253/jtrss.v10i2.994","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.994","url":null,"abstract":"A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCA GAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to, R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"88469689","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"The effects of edible chitosan coating on prolonging the shelf life of green chilies (Capsicum annuum L.)","authors":"Kirubagarani N. Arumugam, N. Md Zain","doi":"10.47253/jtrss.v10i2.990","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.990","url":null,"abstract":"Green chillies (Capsicum annuum L.) are susceptible to pest attack, experiences water loss rapidly in a short time and also experiences chilling injury when stored at a cool temperature that leads to shorter shelf life. Therefore, this study was conducted to examine the effects of chitosan at different concentrations (0.5%, 1.0% and 2.0%) on the shelf life of green chilies stored at ambient temperature (27°C) for 21 days. The effectiveness of the chitosan treatments in extending green chilies’ shelf-life was evaluated by determining their physical and chemical qualities. Coated green chilies are able to preserve for a longer period of time compared to uncoated green chilies. Regardless of any chitosan concentration, the total soluble solid content (TSS) of coated green chilies had increased starting from day 3 to day 21 day as compared to the control. At the highest concentration of 2.0%, chitosan treatment was able to reduce the pH by 28% on day 6 of the storage period, meanwhile, the pH was maintained across the concentration at the end of the storage period (day 21). It was found that the green chilies faced 10 to 22% weight loss across the concentration as compared to the control at the end of the storage period, where the highest weight loss was prominent at 2.0% chitosan. However, in terms of firmness, the chitosan treatments do not give any significant effect on all the treated green chilies. These results suggest that the application of edible chitosan coating contributes to lower pH and weight loss which is responsible for the longer shelf life of the green chilies.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"91499282","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Prenatal zestoretic exposure ameliorates developmental landmarks in rat offspring","authors":"N. P, Srivedi V, Ramachandra Reddy P","doi":"10.47253/jtrss.v10i2.993","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.993","url":null,"abstract":"Zestoretic, a combination of lisinopril and hydrochlorothiozide used as anti-hypertension drug prescribed even during pregnancy. Role of zestoretic on the developmental landmars of young ones exposed prenatally are yet to be established. Hence, the present investigation initiated to test in Wistar rats. Three groups of inseminated female rats were oral gavaged with zestoretic (lisinopril varied concentrations + hydrochlorothiozide 12.5mg) 25, 50 and 100 mg/Kg body weight (BW) on gestation days 7, 9, 11 and 13, whereas control group with double distilled water. Clinical toxicity found in few dams from 50 and 100 mg/Kg BW received rat shown aggressive behavior during experimentation. The developmental landmarks, such as pinna attachment, ear opening, fur development, eye opening, upper and lower incisor eruption, crown rump length, vaginal opening and testes descend were measured periodically on their postnatal days in all the young ones. The number of live pups in zestoretic 50, 100 mg/Kg BW administered females are significantly less (P","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89085996","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"The emerging evidences related to the Inter-relationship between COVID-19 and climate change: A scoping review perspective","authors":"Hayrol Azril Mohamed Shaffril, Asnarulkhadi Abu Samah, Samsul Farid Samsuddin, Hamizah Sahharon","doi":"10.47253/jtrss.v10i2.1006","DOIUrl":"https://doi.org/10.47253/jtrss.v10i2.1006","url":null,"abstract":"Coronavirus Disease 2019 (COVID-19) has affected a number of integral aspects and climate change is one of them. The inter-relationship between COVID-19 and climate change has garnered the interest among scholars across the globe to probe into the related emerging issues. With the escalating number of published articles, a pressing need is present to map and review all available studies in order to capture comprehensive and organised views for future scholars to draw upon the existing pattern of the interchanging correlation between COVID-19 and climate change. This scoping review is guided by a primary research question - what is the inter-relationship between COVID-19 and climate change. Related articles and documents were retrieved from Scopus, Science Direct, and Google Scholars databases. The thematically analysis data were classified into four emerging themes: (1) reduced air pollution, (2) low carbon emission, (3) the impact of temperature and humidity variation on COVID-19, and (4) the impact of air pollution on COVID-19. Variances in the outcomes, particularly on the effects of temperature, humidity, and polluted air on COVID-19, suggest further exploration endeavours. Essentially, the economic impact exerted by COVID-19 and its overall effect on budget to combat climate change remain untapped.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-12-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87089146","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Combination of stabiliser and emulsifier for Pink Guava Juice Drink (PGJD) fortified with Vitamin E","authors":"M. S. Hashim, Faikah Awang @ Ismail","doi":"10.47253/jtrss.v10i1.899","DOIUrl":"https://doi.org/10.47253/jtrss.v10i1.899","url":null,"abstract":"In the beverages industry, the stabilizer and emulsifier were used to enhance the quality of Pink Guava Juice Drink (PGJD) in terms of colour, taste, and texture. Thus, the product is favourable and marketable. This study was conducted to find the best emulsifier combination for PGJD. The combination of six different stabilizers such as Guar gum (GG), Carboxyl methyl cellulose (CMC), Arabic gum (AG), Xanthan gum (XG), Propylene glycol alginate (PGA), and Pectin were applied to PGJD formulation. Meanwhile, about three emulsifiers which are Arabic gum (AG), Polysorbate 80 (P80), and Propylene glycol alginate (PGA) were used to emulsify vitamin E in PGJD. The ratio for both stabilizers and emulsifiers varied accordingly. The most stable and suitable combination of stabilizers and emulsifiers was later added to PGJD. The combination of XG and CMC at the concentration of 70:30 with 0.2% (w/v) was the best stabilizer. Meanwhile, P80 was found to be the best emulsifier at a concentration of 0.8% (w/v) and PGJD fortified with 225 mg of vitamin E was chosen as the most acceptable PGJ among panelists. This finding of the present study can be a guideline for beverage manufacturers in selecting the best stabilizers and emulsifiers.","PeriodicalId":17457,"journal":{"name":"Journal of Tropical Resources and Sustainable Science (JTRSS)","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2022-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89968621","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}