Journal of cellular biochemistry最新文献

{"title":"Septins: Structural Insights, Functional Dynamics, and Implications in Health and Disease","authors":"Aurosikha Das,&nbsp;Ambarish Kunwar","doi":"10.1002/jcb.30660","DOIUrl":"10.1002/jcb.30660","url":null,"abstract":"<div>\u0000 \u0000 <p>Septins are a class of proteins with diverse and vital roles in cell biology. Structurally, they form hetero-oligomeric complexes and assemble into filaments, contributing to the organization of cells. These filaments act as scaffolds, aiding in processes like membrane remodeling, cytokinesis, and cell motility. Functionally, septins are essential to cell division, playing essential roles in cytokinetic furrow formation and maintaining the structural integrity of the contractile ring. They also regulate membrane trafficking and help organize intracellular organelles. In terms of physiology, septins facilitate cell migration, phagocytosis, and immune responses by maintaining membrane integrity and influencing cytoskeletal dynamics. Septin dysfunction is associated with pathophysiological conditions. Mutations in septin genes have been linked to neurodegenerative diseases, such as hereditary spastic paraplegias, underscoring their significance in neuronal function. Septins also play a role in cancer and infectious diseases, making them potential targets for therapeutic interventions. Septins serve as pivotal components of intracellular signaling networks, engaging with diverse proteins like kinases and phosphatases. By modulating the activity of these molecules, septins regulate vital cellular pathways. This integral role in signaling makes septins central to orchestrating cellular responses to environmental stimuli. This review mainly focuses on the human septins, their structural composition, regulatory functions, and implication in pathophysiological conditions underscores their importance in fundamental cellular biology. Moreover, their potential as therapeutic targets across various diseases further emphasizes their significance.</p>\u0000 </div>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"126 1","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142347413","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Revisiting Luteolin Against the Mediators of Human Metastatic Colorectal Carcinoma: A Biomolecular Approach","authors":"Ankita Chakraborty,&nbsp;Advaitha Midde,&nbsp;Pritha Chakraborty,&nbsp;Sourin Adhikary,&nbsp;Simran Kumar,&nbsp;Navpreet Arri,&nbsp;Nabarun Chandra Das,&nbsp;Parth Sarthi Sen Gupta,&nbsp;Aditi Banerjee,&nbsp;Suprabhat Mukherjee","doi":"10.1002/jcb.30654","DOIUrl":"10.1002/jcb.30654","url":null,"abstract":"<div>\u0000 \u0000 <p>Metastatic colorectal carcinoma (mCRC) is one of the prevalent subtypes of human cancers and is caused by the alterations of various lifestyle and diet-associated factors. β-catenin, GSK-3β, PI3K-α, AKT1, and NF-κB p50 are known to be the critical regulators of tumorigenesis and immunopathogenesis of mCRC. Unfortunately, current drugs have limited efficacy, side effects and can lead to chemoresistance. Therefore, searching for a nontoxic, efficacious anti-mCRC agent is crucial and of utmost interest. The present study demonstrates the identification of a productive and nontoxic anti-mCRC agent through a five-targets (β-catenin, GSK-3β, PI3K-α, AKT1, and p50)-based and three-tier (binding affinity, pharmacokinetics, and pharmacophore) screening strategy involving a series of 30 phytocompounds having a background of anti-inflammatory/anti-mCRC efficacy alongside 5-fluorouracil (FU), a reference drug. Luteolin (a phyto-flavonoid) was eventually rendered as the most potent and safe phytocompound. This inference was verified through three rounds of validation. Firstly, luteolin was found to be effective against the different mCRC cell lines (HCT-15, HCT-116, DLD-1, and HT-29) without hampering the viability of non-tumorigenic ones (RWPE-1). Secondly, luteolin was found to curtail the clonogenicity of CRC cells, and finally, it also disrupted the formation of colospheroids, a characteristic of metastasis. While studying the mechanistic insights, luteolin was found to inhibit β-catenin activity (a key regulator of mCRC) through direct physical interactions, promoting its degradation by activating GSK3-β and ceasing its activation by inactivating AKT1 and PI3K-α. Luteolin also inhibited p50 activity, which could be useful in mitigating mCRC-associated proinflammatory milieu. In conclusion, our study provides evidence on the efficacy of luteolin against the critical key regulators of immunopathogenesis of mCRC and recommends further studies in animal models to determine the effectiveness efficacy of this natural compound for treating mCRC in the future.</p></div>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"126 1","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142288028","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Network Pharmacology, Molecular Docking, and Molecular Dynamics Study to Explore the Effect of Resveratrol on Type 2 Diabetes","authors":"Fernando Martínez-Esquivias,&nbsp;Juan Manuel Guzmán-Flores,&nbsp;Andrés Reyes-Chaparro,&nbsp;Sergio Sánchez-Enríquez,&nbsp;Luis Miguel Anaya-Esparza","doi":"10.1002/jcb.30655","DOIUrl":"10.1002/jcb.30655","url":null,"abstract":"<div>\u0000 \u0000 <p>This network pharmacology study represents a significant step in understanding the potential of Resveratrol as an antidiabetic agent and its molecular targets. Targets for Type 2 diabetes were obtained from the MalaCards and DisGeNET databases, while targets for Resveratrol were sourced from the STP and CTD databases. Subsequently, we performed matching to identify common disease-compound targets. The identified genes were analyzed using the ShinGO-0.76.3 database for functional enrichment analysis and KEGG pathway mapping. A protein−protein interaction network was then constructed using Cytoscape software, and hub genes were identified. These hub genes were subjected to molecular docking and dynamic simulations using AutoDock Vina and Gromacs software. According to functional enrichment and KEGG pathway analysis, Resveratrol influences insulin receptors, endoplasmic reticulum functions, and oxidoreductase activity and is involved in the estrogen and HIF-1 pathways. Ten hub genes were identified, including <i>ESR1</i>, <i>PTGS2</i>, <i>SRC</i>, <i>NOS3</i>, <i>MMP9</i>, <i>IGF1R</i>, <i>CYP19A1</i>, <i>MTOR</i>, <i>MMP2,</i> and <i>PIK3CA</i>. The proteins associated with these genes exhibited high interaction with Resveratrol in the molecular docking analysis, and molecular dynamics showed a stable interaction of Resveratrol with ESR1, MMP9, PIK3CA, and PTGS2. In conclusion, our work enhances the understanding of the antidiabetic activity of Resveratrol, which future studies should experimentally corroborate.</p>\u0000 </div>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"126 1","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142288026","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Mechanisms of Sigma-2/TMEM97 Involvement in Cholesterol Metabolism","authors":"Martina Parente,&nbsp;Claudia Tonini,&nbsp;Sara Caputo,&nbsp;Marco Fiocchetti,&nbsp;Valentina Pallottini","doi":"10.1002/jcb.30645","DOIUrl":"10.1002/jcb.30645","url":null,"abstract":"<div>\u0000 \u0000 <p>Extensive research has focused on cellular cholesterol and its regulation, primarily due to its crucial physiological roles and its association with numerous diseases resulting from dysregulated homeostasis. Consequently, investigating cholesterol metabolism and the network of regulating proteins remains an ongoing challenge for biomedical research seeking new molecular targets to manage aberrant cholesterol levels in pathologic conditions. There is evidence that Sigma-2/TMEM97 receptor regulates cholesterol metabolism. However, the mechanisms remain incompletely understood to date. Therefore, this study aimed to employ a pharmacological approach based on selective Sigma-2/TMEM97 agonists, rimcazole and siramesine, to uncover the contribution of this receptor to cholesterol homeostasis. Our results indicate that Sigma-2/TMEM97 activation modulates cholesterol uptake by altering key proteins involved in, leading to free cholesterol and neutral lipids accumulation. This sheds light on potential mechanisms implied, contributing a new piece to the intricate puzzle of cholesterol metabolism homeostasis.</p></div>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"125 10","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-20","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142288025","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Repurposing Non-Nucleosidic Reverse Transcriptase Inhibitors (NNRTIs) to Overcome EGFR T790M-Mediated Acquired Resistance in Non-Small Cell Lung Cancer","authors":"Iqrar Ahmad,&nbsp;Harun M. Patel","doi":"10.1002/jcb.30653","DOIUrl":"10.1002/jcb.30653","url":null,"abstract":"<div>\u0000 \u0000 <p>This study investigates the repurposing potential of non-nucleosidic reverse transcriptase inhibitors (NNRTIs), specifically Rilpivirine and Etravirine, as L858R/T790M tyrosine kinase inhibitors for addressing acquired resistance in non-small cell lung cancer (NSCLC). Using in silico molecular docking, Rilpivirine demonstrated a docking score of −7.534 kcal/mol, comparable to established epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) like Osimertinib and WZ4002. Molecular dynamics (MD) simulations over 200 ns revealed the stability of the Rilpivirine–EGFR complex, with RMSD values ranging from 2.5 to 3.5 Å. The in vitro antiproliferative assays showed that Rilpivirine had an IC₅₀ value of 2.3 µM against H1975 cells, while WZ4002 had an IC₅₀ of 0.291 µM, indicating moderate efficacy. Enzymatic assays revealed that Rilpivirine inhibited the double mutant epidermal growth factor receptor tyrosine kinase (EGFR TK) with an IC₅₀ value of 54.22 nM and spared the wild-type EGFR TK with an IC₅₀ of 22.52 nM. These findings suggest Rilpivirine's potential as a therapeutic agent for NSCLC with EGFR L858R/T790M mutations</p>\u0000 </div>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"126 1","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-19","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142288027","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Targeting TRIM26: Unveiling an Oncogene and Identification of Plant Metabolites as a Potential Therapeutics for Breast Cancer","authors":"Sweta H. Makwana,&nbsp;Tannavi Sharma,&nbsp;Manas K. Mahapatra,&nbsp;Monika Kumari,&nbsp;Akshat Jain,&nbsp;Sandeep K. Shrivastava,&nbsp;Chandi C. Mandal","doi":"10.1002/jcb.30644","DOIUrl":"10.1002/jcb.30644","url":null,"abstract":"<div>\u0000 \u0000 <p>Breast cancer is the major cause of cancer-related mortality and frequent malignancies among women worldwide. The TRIM (Tripartite Motif) protein family is a broad and diverse set of proteins that contain a conserved structural motif known as the tripartite motif, which comprises of three different domains, B-box domain, Coiled-coil domain and RBR (Ring-finger, B-box, and coiled-coil) domain. TRIM proteins are involved in regulating cancer growth and metastasis. However, TRIM proteins are still unexplored in cancer cell regulation. In this study, by using a cancer database expression of all TRIM proteins was determined in breast cancer. Out of 77 TRIM genes, 16 genes were upregulated in breast cancer. Here, the upregulated TRIM26 gene's role is not yet explored in breast cancer. Indeed, TRIM26 is upregulated in 21 cancer types out of 33 cancer types. To investigate the role of TRIM26 in breast cancer, siRNA-mediated gene silencing was carried out in MCF-7 and MDA-MB 231 breast cancer cells. Reduced expression of TRIM 26 decreased cancer cell proliferation, migration and invasion with simultaneous reduction of various proliferative, cell cycle and mesenchymal markers and upregulation of epithelial markers. Further, docking studies found potential novel plant metabolites. Thus, targeting TRIM26 may provide a novel therapeutic approach for breast cancer treatment.</p></div>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"125 10","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142256685","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Exploring Chemical Space to Identify Partial Binders Against hMPV Nucleocapsid Protein","authors":"Monika Verma,&nbsp;Nikita S. Panchal,&nbsp;Pramod Kumar Yadav","doi":"10.1002/jcb.30618","DOIUrl":"10.1002/jcb.30618","url":null,"abstract":"<div>\u0000 \u0000 <p>Human metapneumovirus (hMPV) has gained prominence in recent times as the predominant etiological agent of acute respiratory tract infections. This virus targets children, the elderly, and individuals with compromised immune systems. Given the protracted duration of hMPV transmission, it is probable that the majority of children will have acquired the virus by the age of 5. In individuals with compromised immune systems, recurrence of hMPV infection is possible. As hMPV matures, it remains latent from the time of acquisition. The genome of hMPV encompasses a pivotal protein referred to as the nucleocapsid protein (N). This protein assumes the form of a left-handed helical nucleocapsid, enveloping the viral RNA genome. The primary function of this structure is to protect nucleases, rendering it a potentially promising target for therapeutic advancements. The present study employs a methodology that involves structure-based virtual screening, followed by molecular dynamics simulation at a 250-ns time scale, to identify potential natural molecules or their derivatives from the ZINC Database. These molecules are investigated for their binding properties against the hMPV nucleoprotein. Based on an evaluation of the docking score, binding site interaction, and molecular dynamics studies, it has been found that two naturally occurring molecules, namely M1 (ZINC85629735) and M3 (ZINC85569125), have shown notable docking scores of −9.6 and −10.7 kcal/mol, acceptable RMSD, RMSF, Rg, and so on calculated from molecular dynamics trajectory associated with MMGBSA binding energy of −81.94 and −99.63 kcal/mol, respectively. These molecules have shown the highest binding affinity toward nucleocapsid protein and demonstrated promising attributes as potential binders against hMPV.</p>\u0000 </div>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"126 1","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142256645","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Cover Image, Volume 125, Number 9, September 2024","authors":"Magdalena M. Bolsinger,&nbsp;Alice Drobny,&nbsp;Sibylle Wilfling,&nbsp;Stephanie Reischl,&nbsp;Florian Krach,&nbsp;Raul Moritz,&nbsp;Denise Balta,&nbsp;Ute Hehr,&nbsp;Elisabeth Sock,&nbsp;Florian Bleibaum,&nbsp;Frank Hanses,&nbsp;Beate Winner,&nbsp;Susy Prieto Huarcaya,&nbsp;Philipp Arnold,&nbsp;Friederike Zunke","doi":"10.1002/jcb.30663","DOIUrl":"https://doi.org/10.1002/jcb.30663","url":null,"abstract":"<p><b>Cover Caption</b>: The cover image is based on the article <i>SARS-CoV-2 Spike Protein Induces Time-Dependent CTSL Upregulation in HeLa Cells and Alveolarspheres</i> by Magdalena M. Bolsinger et al., https://doi.org/10.1002/jcb.30627.\u0000\u0000 <figure>\u0000 <div><picture>\u0000 <source></source></picture><p></p>\u0000 </div>\u0000 </figure></p>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"125 9","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-17","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://onlinelibrary.wiley.com/doi/epdf/10.1002/jcb.30663","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142244973","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"RETRACTION: Identification of Nrf2/STAT3 Axis in Induction of Apoptosis Through Sub-G1 Cell Cycle Arrest Mechanism in HT-29 Colon Cancer Cells","authors":"","doi":"10.1002/jcb.30647","DOIUrl":"10.1002/jcb.30647","url":null,"abstract":"<p><b>RETRACTION:</b> I. Tajmohammadi, J. Mohammadian, M. Sabzichi, S. Mahmuodi, M. Ramezani, M. Aghajani, and F. Ramezani, “Identification of Nrf2/STAT3 Axis in Induction of Apoptosis Through Sub-G₁ Cell Cycle Arrest Mechanism in HT-29 Colon Cancer Cells,” <i>Journal of Cellular Biochemistry</i> 120, no. 8 (2019): 14035–14043, https://doi.org/10.1002/jcb.28678.</p><p>The above article, published online on 16 April 2019 in Wiley Online Library (wileyonlinelibrary.com) has been retracted by agreement between the journal Editor-in-Chief, Christian Behl; and Wiley Periodicals, LLC. The retraction has been agreed due to concerns raised by a third party on the data presented in the article. Specifically, some image elements in Figure 4, where found to have been published elsewhere in a different scientific context. The authors did not provide a satisfactory explanation to address the concerns. For these reasons, the editors have lost trust in the accuracy and integrity of the full body of data presented in the article and consider its conclusions invalid.</p><p>All authors have been informed of the decision of retraction. The corresponding author Fatemeh Ramezani, first author Issa Tajmohammadi, and Coauthor Mehdi Sabzichi disagree with the decision of retraction. Coauthor Marjan Aghajani has stated that she did not directly participate in the experiments conducted for the study, and that her role was limited to manuscript editing and language polishing; she neither agreed nor disagreed with the decision of retraction. No confirmation was obtained by the remaining co-authors.</p>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"125 10","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-12","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://onlinelibrary.wiley.com/doi/epdf/10.1002/jcb.30647","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142178595","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Correction to “The Oncolytic Virus H101 Combined with Gnaq Sirna-Mediated Knockdown Reduces Uveal Melanoma Cell Viability”","authors":"","doi":"10.1002/jcb.30648","DOIUrl":"10.1002/jcb.30648","url":null,"abstract":"<p>Li Y, He J, Qiu C, et al. The oncolytic virus H101 combined with GNAQ siRNA-mediated knockdown reduces uveal melanoma cell viability. <i>J Cell Biochem</i>. 2019;120:5766-5776. https://doi.org/10.1002/jcb.27863.</p><p>In the original version of this article, the authors mistakenly duplicated panels in Figure 2A showing the morphological changes of OMM2.3 cells treated with “H101” and “H101+siNC,” as well as in Figure 3A, showing the flow cytometric analysis of OMM2.3 cells in the “NC” and “siGNAQ” groups. In the corrected Figures 2A and 3A below, the authors have replaced the duplicated “H101+siNC” and “siGNAQ” panels with the correct ones, respectively. Additionally, in the correct Figure 3 below, the axis labels have been corrected from “PMT4 Log” to “PI” (Propidium Iodide) and from “PMT2 Log” to “Annexin V-FITC”.</p><p>The legend for Figure 3 is corrected as per below (changes in bold):</p><p><b>Figure</b> 3. Apoptosis was modulated by cotreatment with H101 and siGNAQ. A, Apoptosis of the OMM2.3, 92.1, and OCM1 cell lines was detected with an annexin-V kit and a flow-cytometric analysis. B, At 48 h after transfection, the proportion of <b>early apoptotic cells</b> (<b>Annexin V</b>^<b>+</b> <b>PI</b>^<b>-</b>) <b>was calculated</b>. When H101 was combined with siGNAQ, the apoptosis of UM cells was enhanced relative to that induced by H101 alone. The results are presented as the means and standard error of the mean; *<i>P</i> &lt; 0.05. UM, uveal melanoma.</p><p>Additionally, there is a typographical error in the sequence of the reverse primer for GADPH amplification. The correct sequence is “CAAAGTTGTCATGGATGACC”.</p><p>Finally, the author omitted to mention that the bands for GNAQ and β-actin in Figure 5A are referenced from Figure 1C.</p><p>The authors apologize for these mistakes and for any inconvenience these may have caused.</p>","PeriodicalId":15219,"journal":{"name":"Journal of cellular biochemistry","volume":"125 10","pages":""},"PeriodicalIF":3.0,"publicationDate":"2024-09-06","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://onlinelibrary.wiley.com/doi/epdf/10.1002/jcb.30648","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142140224","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"生物学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}