Environmental biotechnology最新文献

{"title":"Phytoremediation techniques of wastewater treatment","authors":"M. Materac, A. Wyrwicka, E. Sobiecka","doi":"10.14799/EBMS249","DOIUrl":"https://doi.org/10.14799/EBMS249","url":null,"abstract":"Heavy Metals in the Environment: Origin, Interaction and RemediationWastewater Engineering: Advanced Wastewater Treatment SystemsAdvances in Bioremediation and Phytoremediation for Sustainable Soil ManagementPhytoremediation: Role of Aquatic Plants in Environmental CleanUpEmerging Eco-friendly Green Technologies for Wastewater TreatmentBioremediation: Applications for Environmental Protection and ManagementHeavy Metals In The EnvironmentMethods for Bioremediation of Water and Wastewater PollutionEnvironmental Risk Assessment of Soil ContaminationRemoval of Refractory Pollutants from Wastewater Treatment PlantsPhysico-Chemical Wastewater Treatment and Resource RecoverySynergistic Application of a Municipal Waste Material and Phytoremediation Technique for Remediating Acid Mine Drainage and Impacted SoilPlant Ecophysiology and Adaptation under Climate Change: Mechanisms and Perspectives IIPhytoremediationRemoval of Refractory Pollutants from Wastewater Treatment PlantsSoil BioremediationCost Effective Technologies for Solid Waste and Wastewater TreatmentHandbook of Engineering Hydrology (Three-Volume Set)An Integration of Phycoremediation Processes in Wastewater TreatmentDevelopment in Wastewater Treatment Research and ProcessesPhytoremediationHandbook of Research on Microbial Tools for Environmental Waste ManagementRecent Advancements in Bioremediation of Metal ContaminantsEmerging and Eco-Friendly Approaches for Waste ManagementThe Role of Phytoremediation in Remediation of Industrial WastePhytoremediation Technology for the Removal of Heavy Metals and Other Contaminants from Soil and WaterPhytoremediationEcological Assessment of Wastewater Treatment TechnologiesSOUVENIR of 4th International Science CongressGreen Materials for Wastewater TreatmentBioremediation and Green TechnologiesWastewater Treatment EngineeringPhytoremediation of Contaminated Soil and WaterContamination of WaterApplication of Microalgae in Wastewater TreatmentNew Trends in Removal of Heavy Metals from Industrial WastewaterWastewater TreatmentAdvanced Treatment Techniques for Industrial WastewaterIntroduction to PhytoremediationPhytoremediation","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2015-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75107363","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Toxicity analysis of coke wastewater treated in a rotating biological contactor and a membrane bioreactor","authors":"M. Tomaszewski, Karina Pypeć, A. Zgórska, A. Ziembińska-Buczyńska","doi":"10.14799/EBMS252","DOIUrl":"https://doi.org/10.14799/EBMS252","url":null,"abstract":"To investigate the effectiveness of a rotating biological contactor (RBC) and a two-stage membrane bioreactor (MBR) for the treatment of coke wastewater, samples were collected three times (Batches I, II, III) from the “Jadwiga” coke plant in Zabrze, Poland at two-week intervals. The wastewater was then diluted with tap water (1:3 ratio, wastewater: tap water) and then treated at retention times of 4.1 days (RBC) and 7 days (MBR). For phytotoxicity and genotoxicity tests, the wastewater was sampled from various points in the treatment systems and further diluted to produce a range of concentrations. In the phytotoxicity tests (growth inhibition), Lemna minor and Vicia faba were used. A low concentration of wastewater (6.25%) often stimulated growth. © UNIVERSITY OF WARMIA AND MAZURY IN OLSZTYN ABBREVIATIONS CA chromosome aberration EC50 half maximal effective concentration Embr effluent, after wastewater treatment in MBR Erbc effluent, after wastewater treatment in RBC Fmbr flow between two units of MBR reactor INF influent, wastewater after preliminary treatment, diluted four times with tap water before biological treatment MBR two-stage membrane bioreactor","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2015-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77397485","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Surface tension technique as a strategy to evaluate the adsorption of biosurfactants used in soil remediation","authors":"Z. Gusiatin","doi":"10.14799/EBMS267","DOIUrl":"https://doi.org/10.14799/EBMS267","url":null,"abstract":"This study investigated the adsorption of two biosurfactants, non‐ionic saponin and anionic Reco-10 (a mixture of rhamnolipids). The experiments were performed with three different soils (sandy clay loam, clay loam, clay) and at two soil/biosurfactant ratios, m/V=1/10 and 1/40. Using a tensiometer, surface tension in aqueous biosurfactant solutions and their supernatants was measured and the critical micelle concentration © UNIVERSITY OF WARMIA AND MAZURY IN OLSZTYN INTRODUCTION Surfactants are amphiphilic compounds (containing hydrophobic and hydrophilic portions) that reduce the free energy of a system by replacing bulk molecules of higher energy at an interface (Mulligan 2005). Due to their ability to lower surface/interfacial tension, and to increase solubility, detergency power, wetting ability and foaming capacity, surfactants have a wide range of applications in many fields, such as the petroleum or pharmaceutical industries. In addition, surfactants monomers aggregate in micelles at a specific concentration, which not only reduces surface and interfacial tension, but also facilitates the desorption of pollutants and increases their bioavailability in soils or sediments. These properties mean that surfactants can be used in many surfactant-enhanced remediation systems like soil washing (Mao et al. 2015; Mulligan 2009), electrokinetic processes (Saichek and Reddy 2005), phytoremediation (Liu et al. 2013) and bioremediation (Pacwa-Plociniczak et al. 2011). Up to now, different ionic (anionic, cationic) and non-ionic surfactants have been tested for soil remediation. Anionic synthetic surfactants that have been tested include sodium dodecyl sulphate (SDS), bis(2-ethylhexyl) sulfosuccinate sodium (AOT) and linear sodium alkene sulfonates (Spolapon AOS). As a cationic surfactant, cetyltrialkyl ammonium bromide (CTAB) has been used. In contrast to ionic surfactants, nonionic surfactants have lower toxicity and greater capacity to solubilize contaminants, so they are more commonly used in remediation projects than ionic (Zheng et al. 2012). Although ionic surfactants are highly efficient at removing various pollutants 28 ENVIRONMENTAL BIOTECHNOLOGY 11 (2) 2015 such as PCBs, petroleum,NAPLs andBTEX, their toxicity can limit their usefulness (Mao et al. 2015). Currently, biosurfactants appear more attractive than synthetic surfactants for surfactant-based soil remediation. Biosurfactants are natural surface active agents produced by bacteria, fungi and yeast, or extracted from plants (Paria 2008). They have a larger molecular structure and more functional groups than synthetic surfactants, which enables them to remove both hydrophobic organics and heavy metals. The biosurfactants commonly used in soil remediation are anionic rhamnolipids secreted by Pseudomonas aeruginosa (Juwarkar et al. 2007; Muligan 2009) and non-ionic saponin of plant origin (Hong et al. 2002). Biosurfactants differ in their properties and can behave in soil in different ways. ","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2015-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"79027563","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Selection of optimal spawner‑pairs based on the polymorphism of microsatellite loci in a partially‑tetraploid fish species (Coregonus lavaretus)","authors":"D. Kaczmarczyk, D. Fopp‐Bayat, A. Wiśniewska","doi":"10.14799/EBMS255","DOIUrl":"https://doi.org/10.14799/EBMS255","url":null,"abstract":"how to adapt this technique to the selection of spawner pairs for restocking populations of partially tetraploid fish species. To test our calculation techniques, we used actual data on the polymorphism of the loci of captured whitefish (Coregonus lavaretus). The data enabled calculations showing which spawner pairs would create the most genetically diverse cohort of offspring if they were bred. The method presented in the paper can be used for breeding fish in aquaculture conditions to help conserve species. Selection of optimal spawner‐pairs based on the polymorphism of microsatellite loci in a partially‐tetraploid fish species (Coregonus lavaretus)","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2015-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"73929550","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Application of by-products and waste in the synthesis of nanosilver particles","authors":"B. Trepanowska, Michał Łuczyński, S. Kulesza, M. Adamczak","doi":"10.14799/EBMS257","DOIUrl":"https://doi.org/10.14799/EBMS257","url":null,"abstract":"Energy dispersive X-ray spectroscopy showed that elements that typically stabilize nanoparticles were present. The well diffusion method (nutrient agar medium) indicated that AgNP synthesized with raspberry leaf extract exerted strong bacteriostatic and bactericidal activity against Gram-negative bacteria and weaker activity against Gram-positive bacteria. Although further analysis is needed to determine the mechanism of their synthesis, the results of this study show that plant-extract based synthesis can produce nanoparticles with controlled size and morphology. Application of by-products and waste in the synthesis of","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2015-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89135208","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Substrate influence on the structure of methanogenic Archaea communities during anaerobic digestion","authors":"D. Dąbrowska, K. Bułkowska, S. Ciesielski","doi":"10.14799/EBMS264","DOIUrl":"https://doi.org/10.14799/EBMS264","url":null,"abstract":"This study compares the diversity of methanogenic archaeal communities that developed during biogas production in reactors fed with different substrates. Reactor I was fed with silages of maize and of alfalfa and timothy; and Reactor II was fed with these silages plus pig slurry and glycerol as co‐substrates. The archaeal community structure was studied using polymerase chain reaction–denaturing gradient gel © UNIVERSITY OF WARMIA AND MAZURY IN OLSZTYN IN TRO DUC TION Methane fermentation has recently been a subject of much interest because methane is a renewable energy source and fermentation provides a way to utilize waste. For better methane production, the process parameters can be adjusted for the specific waste product being used as a substrate, and co-substrates can be added. In this way, greater process stability can be achieved, and the quantity and methane content of biogas can be increased (Bułkowska et al. 2012). Although it is known that the Archaea are one of the groups of microorganisms that perform methane fermentation, their community structure and diversity are poorly understood, as is the effect of conditions in the bioreactor on these community characteristics (Ciesielski et al. 2013). For example, the choice of feedstock can affect these characteristics (Ziganshin et al. 2013). The feedstock that is chosen can come from a variety of industries, and its choice can depend on the availability of raw materials. Although in Europe, the materials most commonly used in biogas production are plant-based, some animal-derived organic wastes and other organic wastes are also used, such as pig slurry or glycerol from the biodiesel industry (Hijazi et al. 2016). The effect on biogas production of addition of substrates that are not plant-based has been investigated (Bułkowska et al. 2012). However, little is known about how the diversity of the archaeal community is affected when glycerol and pig slurry are added as co-substrates to plantbased substrates. 42 ENVIRONMENTAL BIOTECHNOLOGY 11 (2) 2015 column was then centrifuged for 1 minute at high speed before the filtrate was poured out and washed twice with A1 solution (A&A Biotechnology). The DNA was then suspended in 50μL of water and stored at -20°C until further analysis. Polymerase chain reaction Genomic DNA was amplified using polymerase chain reaction (PCR). The gene fragment encoding for 16S rRNA was amplified using a pair of primers (GC-0357F-5’ CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCC CGCCCGCCCTACGGGGCGCAGCAG 3’; 0691R-5’ GG ATTACATGATTTCAC 3’) (Watanabe et al. 2004). The amplified fragments measured approximately 500bp. The PCR mix (30μL per reaction) was composed of 3μL of 10×PCR buffer, 2.4μL MgCl2 (25mM), 1.3μL of dNTPs (200μM final concentration), 0.15μL Taq polymerase (2 U·1μL-1·reaction-1), 0.5μL of each primer (20pmol), 18.15μL of dH2O and 1μL of genomic DNA. Reactions were performed in 0.5mL DNA-free PCR tubes using a thermocycler, and the PCR steps were as follows: denaturat","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2015-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75474977","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Dichlorodiphenyldichloroethylene (DDE) residue limit exceeded in pig tissues after feed-borne exposure to maximum allowed concentration","authors":"M. Woźny, E. Jakimiuk, P. Brzuzan, M. Florczyk, A. Niewiadowska, K. Obremski, M. Gajęcka, J. Młynarczuk, M. Gajęcki","doi":"10.14799/EBMS242","DOIUrl":"https://doi.org/10.14799/EBMS242","url":null,"abstract":"Monitoring of undesirable substances by the European Union indicates a presence of natural and anthropogenic pollutants in animal feed that may be of concern for the producers, as well as the veterinary services. Although the literature concerning toxicity of DDT (an insecticide widely used in the past) is extensive, less attention has been focused on the biological properties of DDE and its interactions with other contaminants. This study reports on the concentration profile of p,p’-DDE and two other ogranochlorines (p,p’-DDT, p,p’-DDD) in different tissues of immature gilts after 14, 28, and 42 days of oral exposure to p,p’-DDE alone (0.5mg·kg-1feed·day-1) and in mixture with naturally occurring mycotoxin zearalenone, ZEN (0.5+0.1mg·kg-1feed·day-1). The treatment resulted in a time© UNIVERSITY OF WARMIA AND MAZURY IN OLSZTYN INTRODUCTION Dichlorodiphenyltrichloroethane (DDT) is an organochlorine pesticide, used worldwide in the past to control insect vectors of infectious diseases (Rogan and Chen 2005). DDTwas also used as an insecticide to protect crops, including Poland, before it was banned in most countries in the 1970’s for its negative effects on humans, wildlife, and the environment. Despite the ban, this insecticide is still used as a cost-effective method to prevent malaria in some tropical regions (Bettinetti et al. 2011). DDT is a highly persistent pollutant. In the environment, it may last for many years, as it is slowly biodegraded to DDE (dichlorodiphenyltrichloroethylene) and DDD (dichlorodiphenyldichloroethane) in processes generally driven by the action of microorganisms in the soil (ATSDR 2002). Common and intensive use of DDT has resulted in worldwide pollution with this compound. It has been found in organisms living in deserts as well as in the depths of oceans (Turusov et al. 2002). Since the times of DDT extensive use, its residual levels in the environment have greatly declined. 2 ENVIRONMENTAL BIOTECHNOLOGY 11 (1) 2015 However, due to its persistence, the pesticide will be present at low concentrations for decades (Glynn et al. 2009; NTP 2011). Current human exposure to DDT and its metabolites is known to occur mainly through dietary intake, particularly consumption of contaminated fish or meat (ATSDR 2002; NTP 2011). Technical grade DDT is a mixture of different isomers: approximately 85% of the p,p-DDT isomer with o,p’-DDT and o,o’-DDT present in lesser amounts (ATSDR 2002). In mammals, the p,p’-DDT isomer is metabolized mainly to p,p’-DDE and p,p’-DDD by the microsomal cytochrome P450 system (Kitamura et al. 2002). Due to their high lipophilic properties (p,p’-DDD<p,p’-DDT<p,p’-DDE), these compounds are readily distributed to the body once absorbed and stored in the tissues in proportion to the tissues’ lipid content; and they leave the body very slowly. This bioaccumulation leads to increasing concentrations of the compounds at higher trophic levels (ASTDR 2002). The literature concerning the biological properties o","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2015-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"79964308","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"American funding for biofuel/biorefinery research and development","authors":"D. Gallinaro","doi":"10.14799/EBMS243","DOIUrl":"https://doi.org/10.14799/EBMS243","url":null,"abstract":"","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2014-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87733956","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Biomass from field crop production as an energy source and a new activity area for economic operators at the local level","authors":"Z. Brodziński, K. Kurowska, Hubert Kryszk","doi":"10.14799/EBMS225","DOIUrl":"https://doi.org/10.14799/EBMS225","url":null,"abstract":"derived from RES is favourable for both reduction of pollutant emissions to the atmosphere and water, and reduction of the volume of waste generated. This paper identifies the potential of biomass production for energy purposes in the region of Warmia and Mazury (Poland), which could be a key action for sustainable development of rural areas and investment activity. Biomass from field crop production as an energy source","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2014-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"79218945","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Tannic acid as a cost ‑effective substitute for saponin in soil remediation","authors":"Z. Gusiatin, K. Bułkowska, T. Pokój","doi":"10.14799/EBMS240","DOIUrl":"https://doi.org/10.14799/EBMS240","url":null,"abstract":"The efficiency of soil washing with tannic acid (TA) and saponin (SAP) was compared. In the contaminated soil, Cu and Zn were more mobile than Pb. At 3% concentration, both biosurfactants removed similar amounts of Zn (48 and 54%, respectively), SAP removed somewhat more Cu (81%), and TA removed considerably more Pb (63%). SAP removed more Cu due to its","PeriodicalId":11733,"journal":{"name":"Environmental biotechnology","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2014-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"83226124","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}