Substrate influence on the structure of methanogenic Archaea communities during anaerobic digestion

This study compares the diversity of methanogenic archaeal communities that developed during biogas production in reactors fed with different substrates. Reactor I was fed with silages of maize and of alfalfa and timothy; and Reactor II was fed with these silages plus pig slurry and glycerol as co‐substrates. The archaeal community structure was studied using polymerase chain reaction–denaturing gradient gel © UNIVERSITY OF WARMIA AND MAZURY IN OLSZTYN IN TRO DUC TION Methane fermentation has recently been a subject of much interest because methane is a renewable energy source and fermentation provides a way to utilize waste. For better methane production, the process parameters can be adjusted for the specific waste product being used as a substrate, and co-substrates can be added. In this way, greater process stability can be achieved, and the quantity and methane content of biogas can be increased (Bułkowska et al. 2012). Although it is known that the Archaea are one of the groups of microorganisms that perform methane fermentation, their community structure and diversity are poorly understood, as is the effect of conditions in the bioreactor on these community characteristics (Ciesielski et al. 2013). For example, the choice of feedstock can affect these characteristics (Ziganshin et al. 2013). The feedstock that is chosen can come from a variety of industries, and its choice can depend on the availability of raw materials. Although in Europe, the materials most commonly used in biogas production are plant-based, some animal-derived organic wastes and other organic wastes are also used, such as pig slurry or glycerol from the biodiesel industry (Hijazi et al. 2016). The effect on biogas production of addition of substrates that are not plant-based has been investigated (Bułkowska et al. 2012). However, little is known about how the diversity of the archaeal community is affected when glycerol and pig slurry are added as co-substrates to plantbased substrates. 42 ENVIRONMENTAL BIOTECHNOLOGY 11 (2) 2015 column was then centrifuged for 1 minute at high speed before the filtrate was poured out and washed twice with A1 solution (A&A Biotechnology). The DNA was then suspended in 50μL of water and stored at -20°C until further analysis. Polymerase chain reaction Genomic DNA was amplified using polymerase chain reaction (PCR). The gene fragment encoding for 16S rRNA was amplified using a pair of primers (GC-0357F-5’ CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCC CGCCCGCCCTACGGGGCGCAGCAG 3’; 0691R-5’ GG ATTACATGATTTCAC 3’) (Watanabe et al. 2004). The amplified fragments measured approximately 500bp. The PCR mix (30μL per reaction) was composed of 3μL of 10×PCR buffer, 2.4μL MgCl2 (25mM), 1.3μL of dNTPs (200μM final concentration), 0.15μL Taq polymerase (2 U·1μL-1·reaction-1), 0.5μL of each primer (20pmol), 18.15μL of dH2O and 1μL of genomic DNA. Reactions were performed in 0.5mL DNA-free PCR tubes using a thermocycler, and the PCR steps were as follows: denaturation at 94°C for 10min, followed by 30 cycles of denaturation at 94°C for 1min, annealing at 54°C for 1min in the initial cycle, and then for a period that was 2 seconds shorter after each subsequent cycle, and extension at 72°C for 1min. After completion, an additional extension step was performed at 72°C for 10min, and the samples were then chilled to 4°C. The length of the PCR product was verified on 1% agarose gel, stained with ethidium bromide, and visualized and photographed under UV light. Denaturing Gradient Gel Electrophoresis (DGGE) PCR products with a GC clamp were resolved in 6% polyacrylamide gel (37.5:1 acrylamide:bisacrylamide) with a gradient ranging from 30 to 60% urea. Electrophoresis was performed for 12h at 60V in 1xTAE buffer (2M Tris base, 2M acetic acid, 0.05M EDTA) using the DCodeTM Universal Mutation Detection System (Bio-Rad Laboratories Inc., U.S.A.). The DNA mixture resolved in gel was visualized by staining with 1:10,000 SybrGold (Invitrogen) for 20 minutes followed by UV transillumination. Images were recorded and analyzed with KODAK 1D 3.6 Image Analysis Software.