Journal of Sulaimani Medical College最新文献

{"title":"MOTHER’S KNOWLEDGE AND BELIEFS ABOUT HOME MANAGEMENT FOR INFANT COLIC IN RAPARIN ADMINISTRATION","authors":"Himdad Sofi, Ibrahim Mustafa","doi":"10.17656/jsmc.10426","DOIUrl":"https://doi.org/10.17656/jsmc.10426","url":null,"abstract":"BackgroundInfant colic is a difficult and complex experience for parents and infants in the first few months of their lives, which causes excessive crying and discomfort for infants as well as anxiety and distress for mothers. ObjectivesTo assess the level of information and beliefs that influence mothers regarding home management for reducing infant colic.  Materials and MethodsA cross-sectional descriptive study was conducted in the Raparin administration from the period of 15 May 2022 to 15 July 2022. Participated mothers in this study was 245 who had one or more children and visited the hospital for treatment, the data was obtained through direct interview by questionnaire which included demographic characteristic, 15 items regarding information, 10 items about foods that cause infant colic and 17 items concerning to method used to eliminate infant colic. The data were analyzed through the SPSS program and the chi-square test was used to find the association. ResultsThe results demonstrate that the majority of mothers (47.6%) who participated were between in the age group (30-39) years old, followed by (75.9%) of mothers were living in urban places, and the majority of mothers (86.1%) were housewife. As well as it has also been revealed that mothers had good knowledge (81.7%) and concerning the beliefs (42.6%) of samples know practices used to reduce infant colic. Concerning significance, there was no significant association between the mother’s knowledge and their socio-demographic characteristics and there was a significant association between the mother’s beliefs and (occupational status) at p-value < 0.046. ConclusionThe mothers had good knowledge about infant colic and cultural influence still impacts mothers’ beliefs regarding home management for infant colic. Mothers’ knowledge had a non-significant association with their demographic features and a significant association between mother’s beliefs and their occupational status.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"170 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139338062","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"KNOWLEDGE AMONG SULAIMANIYAH POPULATION TOWARDS INJECTABLE FACIAL FILLERS","authors":"Shahen Omer, Zanyar Amin, Falah A. Hawramy","doi":"10.17656/jsmc.10427","DOIUrl":"https://doi.org/10.17656/jsmc.10427","url":null,"abstract":"BackgroundAny operation that involves cosmetic correction and alteration of existing bodily features is referred to as a cosmetic procedure. It also covers surgical operations like liposuction, rhinoplasty, breast augmentation, and minimally invasive procedures like botulinum toxin injections and fillers. ObjectivesTo explore and evaluate participants’ personal and subjective views on facial fillers in the Sulaimani governorate. Patients and MethodsOne hundred and sixty-one participants were recruited over three months from 6 January 2022 to 8 April 2022; all the participants were approached with a questionnaire regarding their personal and subjective views on facial fillers, and informed consent was taken before participating. ResultsThe recruited population for the work includes 111 females and 60 males, with an F/M ratio of 1.85. The main reason listed by most of the participants (n=102, 69.56%) who have or are considering undergoing facial fillers are their concerns about visible ageing signs and facial appearance; the (n=29, 18.01%) listed that people’s influence and the fact that they compare themselves with other people and people from the social media has encouraged them to opt facial fillers. ConclusionHalf of the participants understood the procedure enough, although they needed more information regarding the facial fillers’ side effects. Most participants do not even feel they would need to hide that they have undergone any procedure, which is the ultimate level of acceptance.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"2 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139337860","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"SERUM IGM AND IGG TITERS 2 WEEKS AND 8 WEEKS FROM BEGINNING OF SYMPTOMS AND THEIR RELATION TO SEVERITY IN COVID-19","authors":"Sabir Amin, Mohamed Al-Shaikhani, Rebwar Abdulrahman","doi":"10.17656/jsmc.10421","DOIUrl":"https://doi.org/10.17656/jsmc.10421","url":null,"abstract":"BackgroundCOVID-19 pandemic, which started in late December 2019, has resulted in a significant number of morbidity and mortality worldwide. Estimating serum antibody titers of both IgM & IgG against the coronavirus in patients plays a crucial role in diagnosis and assessing the severity of the infection. ObjectivesOur objective is to assess IgM and IgG levels at 2 and 8 weeks from the onset of COVID-19 symptoms and examine their relationship with disease severity and mortality. Additionally, we aim to determine how these antibody levels relate to patient age, BMI, gender, and any chronic illnesses they may have. Patients and MethodsThis prospective study was conducted at Dr. Hemn Teaching Hospital in Sulaymaniyah, from December 4th, 2021 to March 5th, 2022. It included 33 males and 28 females, aged between 17 and 92 years, all of whom were confirmed to have COVID-19 by Reverse Transcription Polymerase Chain Reaction and/or High-resolution computed tomography. Blood samples were taken 2 and 8 weeks from starting symptoms and processed by ELISA to detect IgM and IgG titers. ResultsMale patients accounted for 54.1%, and 63.93% were between 30-70 years of age, with 90.16% residing in the city center. The majority were non-smokers (68.85%), and 86.89% did not consume alcohol. In terms of infection severity, 22.95% had mild cases, 40.98% were moderate and 36.07% were severe-critical infections. We observed that higher antibody titers in the early phase were associated with increasing severity and mortality. A higher body mass index was identified as a risk factor for elevated antibody production while hypertension and diabetes were not. ConclusionOur findings suggest that higher levels of IgM and IgG antibodies during the early phase of COVID-19 are associated with increased disease severity and, consequently, higher mortality rates. Furthermore, a higher BMI was found to be a risk factor for elevated antibody production. After 8 weeks from symptoms, IgG levels remained elevated, while IgM levels declined sharply.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"15 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139338028","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"SURVIVAL OUTCOMES AMONG PATIENTS WITH HIGH-GRADE GLIOMA: A SINGLE INSTITUTION RETROSPECTIVE STUDY","authors":"Hawbir Gharib, Ari Nadhim, B. Muhsin","doi":"10.17656/jsmc.10414","DOIUrl":"https://doi.org/10.17656/jsmc.10414","url":null,"abstract":"BackgroundThe prognosis for glioma patients is poor, despite recent advances in diagnosis and treatment. Understanding Glioma’s clinical characteristics and predictive factors is crucial for patient treatment and management. ObjectivesTo assess the survival duration of HGG patients at a single facility and to discover clinical determinants of treatment outcome in HGG treated with a combined modality approach in Zhianawa Cancer Center. Patients and MethodsThis study included 133 patients with high-grade gliomas diagnosed between January 2015 and January 2020; these patients were referred to the Zhianawa Cancer Center. A retrospective analysis of the clinical data included survival outcomes, tumour characteristics, and demographic information. While the Cox regression model was used for the evaluation of multivariate data to look at the risk factors for mortality, on the other hand, survival data were analyzed using Kaplan-Meier curves with a log-rank test. ResultsIn this particular patient cohort, grade IV glioma (83.9%), grade III glioma  (16.1), and glioblastoma  (81.4%) were the most common pathological types. A poor prognosis was associated with not using temozolomide, having a Karnofsky Performance Score (KPS) of less than 70%, and not receiving radiotherapy. Univariate analysis showed low KPS (70) to increase the risk of mortality. Patients who had radiotherapy with normal fractionation, concurrent chemotherapy, and radiotherapy adjuvant chemotherapy had the highest overall survival rates. ConclusionMortality was significantly related to aging, absence of seizures, presence of motor alteration, pathological grade IV gliosarcoma, glioblastoma multiform, and non-standard radiation dose.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"36 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139338147","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"TREATMENT OUTCOMES OF UTERINE CARCINOMA: A SINGLE INSTITUTION RETROSPECTIVE STUDY","authors":"Bakhan Karim, C. Fattah, Jalil Ali","doi":"10.17656/jsmc.10422","DOIUrl":"https://doi.org/10.17656/jsmc.10422","url":null,"abstract":"BackgroundEndometrial cancer has a lifetime risk of 2.6% for women living in industrialized countries and it is the most prevalent kind of cancer diagnosed in those regions. In terms of gynecologic cancer-related deaths, it ranks after ovarian and cervical cancer as the third most common cause. ObjectivesTo evaluate endometrial cancer patients’ long-term treatment outcomes, including disease-free survival and overall survival, as well as to pinpoint independent predictive markers. Materials and MethodsAt the Zhianawa Cancer Center, a retrospective analysis was conducted. All patients who had been referred for radiation therapy between March 2009 and January 2019 were included in the research, except those who had distant metastases. In the end, 89 patients were included. Using the Kaplan-Meier technique, overall survival and disease-free survival were calculated, and the significance of the variations across curves was evaluated using the log-rank test. ResultsAll patients underwent surgery, 96.6% received adjuvant radiotherapy, and 42.7% received concomitant chemotherapy. The 5-year and 10-year disease-free survivals were 62.9% and 56.2%, and the overall 5-year and 10-year survivals were 74.2% and 66.3% respectively. The statistically significant variables impacting disease-free survival were lymphovascular invasion and marginal status, and the only statistically significant prognostic variable affecting overall survival was the FIGO stage. ConclusionIn this analysis, we concluded that uterine cancer has a good prognosis, and its outcome was influenced by stage, lymphovascular space invasion, and surgical marginal status.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"10 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139337999","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"VALIDATION OF THE KURDISH LANGUAGE VERSION OF THE STANDARDIZED COSMESIS AND NASAL OUTCOMES SURVEY (SCHNOS), APPLICATION FOR SEPTORHINOPLASTY HEALTH","authors":"K.A. Qaradaxi, Haidar Mohammed, Hawree Hasan, Zana Aziz, Hiwa Khan, Kazim Kakways, Kawa Marof","doi":"10.17656/jsmc.10419","DOIUrl":"https://doi.org/10.17656/jsmc.10419","url":null,"abstract":"Background The Standardized Cosmesis and Health Nasal Outcomes Survey (SCHNOS) questionnaire is a recent tool for evaluating patient satisfaction in both functional and cosmetic components of rhinoplasty. It is a reliable, steady, and corroborated patient-reported outcome measure that is not available in Kurdish. Objectives To evaluate the application of the Kurdish version of the Standardized Cosmesis and Health Nasal Outcomes Survey (SCHNOS) scale for Septorhinoplasty surgery and research. Materials and Methodsconducted four centre studies to validate The Kurdish version of the scale We adhered to a strict translation procedure, including a forward and back translation and reconciliation interviews, to ensure the original content and concepts were preserved compared for patients and control groups and tailored to the demographic the instrument was intended for. Resultsshowed that the Kurdish version of the SCHNOS was conceptually comparable to the original English version and demonstrated high internal consistency for nasal function as an aesthetic postoperative outcome. The Spearman rank correlation analysis indicated a weak to moderate correlation between the different items, indicating that the different items measure somewhat distinct aspects of nasal function and appearance. However, the high Cronbach’s alpha values suggested that the different items measure similar aspects of nasal function and appearance and can be considered a reliable scale for assessing SCHNOSE.The results of the paired samples t-test showed significant differences between the preoperative and postoperative obstructive and aesthetic SCHNOSE scores, indicating that the observed differences are likely to be real and not simply due to random variation in the data. ConclusionThe Kurdish form of the SCHNOS demonstrates virtuous reliability and validity, coherent with the original version. Thus, it can be used as a validated questionnaire for outcome measurements for rhinoplasty. This version should be recommended to evaluate both functional and cosmetic outcomes in daily practice and rhinoplasty-related examinations.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"23 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139338008","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"ASSESSMENT OF THE LEVEL OF STRESS AMONG PATIENTS WITH HEART FAILURE IN SULAIMANI CARDIAC HOSPITAL","authors":"Bayan Sharif, Mohammed Mohammed, Hadeel Ibrahim","doi":"10.17656/jsmc.10423","DOIUrl":"https://doi.org/10.17656/jsmc.10423","url":null,"abstract":"BackgroundLife events and experiences eventually lead to stress. Stress also activates one’s process of thinking and autonomic arousal level. One of the complications of heart failure is coronary artery disease, which can also be caused by stress and behaviours like being extremely hardworking toward achieving one’s goals. ObjectivesTo detect the stress levels of heart failure patients, and to find out the association between socio-demographic characteristics and level of stress. Materials and MethodsQuantitative descriptive design (non-probability purposive sample). The sample was the heart failure admitted to Sulaimani Cardiac Hospital. A total of 200 heart failure patients were selected by non‑probability sampling methods. The standardized Perceived Stress Scale tool was used for the study. ResultsAlmost half (50.5%) of the sample was between 62 to 77 years. More than half were males, widows, illiterate with low economic status, and lived with their family members (65.5, 53%, 61%, 65.5%, and 68%) respectively. Less than half (48%) of them were in class III of heart failure according to the New York Heart Association classification.  Most of the sample were from urban areas (91%), Nearly half of the sample (47.5%) had a high level, (51%) had moderate stress, and only (1.5%) of them had low stress. Also, the present study revealed a significant association among all items of sociodemographic and clinical characteristics and levels of stress except the economic state, marital state, and resident at the p-value of 0.05. ConclusionThis research demonstrated an approach to developing more coping strategies to reduce stress among heart failure patients. So, this study recommended that the medical staff who work in the coronary care unit should involve themselves in dealing with the psychosocial needs of those patients and take measures to plan to solve their problems, especially stress, through teamwork.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"253 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139337905","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"NURSES’ KNOWLEDGE AND ADHERENCE TO CLINICAL PRACTICE GUIDELINE TO PREVENT EXTRAVASATION OF CHEMOTHERAPY IN ERBIL CITY","authors":"Dler Ismael, C. Qadir, Azaddin Mahmod","doi":"10.17656/jsmc.10425","DOIUrl":"https://doi.org/10.17656/jsmc.10425","url":null,"abstract":"BackgroundKnowledge is the cornerstone of providing safe nursing care. However, to do so, they require access to the most recent clinical information and guidance. ObjectivesThis study aimed to determine the nurses’ knowledge and adherence to clinical practice guidelines to prevent chemotherapy-related extravasation Materials and MethodsDescriptive cross-sectional design was used, 70 oncology nurses who administer chemotherapeutic drugs were selected in both Rizgary Teaching Hospital and Nanakaly Hospital for blood disease in Erbil City, from June 2022 to May 2023, data was collected through a structured interview questionnaire consisting of demographic data of nurses, knowledge about extravasation of chemotherapy, adherence to clinical practical guideline and barrier adherence to clinical practical guideline, data analyzed by using mean, standard deviation, frequency, percentage, Chi-square and binary logistic regression were used to find out the result of the study, and, a p-value less than 0.05 is considered significant. ResultsConcerning the overall level of knowledge of oncology nurses 55.7% had inadequate knowledge, 61.4% of them had low adherence to clinical practice guidelines, and the factors associated with low adherence to clinical practice guidelines was lower level of education  (P-value=0.007, OR= 0.63), inadequate knowledge, (P-value= 0.041, OR=6.48), and high perceived barrier (P-value=0.004, OR= 9.87), the most commonly reported barriers was lack of continuing education to update nursing information and poor applicability of clinical practice guideline in real-world practice. ConclusionThe clinical practice guideline adherence rate of nurses concerning chemotherapy administration was low because most oncology nurses had inadequate knowledge and high perceived barriers consequently the study highlighted the significance of continuing education to maintain oncology nursing staff with the updated evidence-based guidelines.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"170 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139337946","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"ASXL1 MUTATION ANALYSIS IN CHRONIC MYELOID LEUKAEMIA PATIENTS","authors":"Aras Mohammed, Dlnya Mohamad, Hamid Mohammed","doi":"10.17656/jsmc.10416","DOIUrl":"https://doi.org/10.17656/jsmc.10416","url":null,"abstract":"BackgroundIn recent years, additional sex comb-like 1 (ASXL1) gene mutations have recently been linked to several myeloid cancers. Objectives To characterize ASXL1 mutation prevalence, determine if these abnormalities might constitute a significant event in CML prognosis, and establish the correlations if these mutations are associated with CML transformation and/or imatinib (IM) resistance, Here we designed a study to investigate ASXL1 gene that is frequently mutated in myeloid malignancies and evaluated their occurrence in a well-defined group of CML patients. Patients and MethodsThe study population consists of 80 patients diagnosed with CML under treatment with TKI (Imatinib 400,600,800 mg/day and Nilotinib). Ten healthy subjects were checked as controls. Depending on their molecular and/or cytogenetic response, CML patients will either be classified into imatinib-resistant or imatinib-good responders. Then the DNA was extracted depending on the Salting-Out protocol. Then genome amplification was performed on exon 12 and in the HOT spot region for the detection of somatic mutations, using conventional PCR. ResultsNine out of 80 CML samples (11.25%) were determined to have mutations with the ASXL1 gene. We identified a novel Mutation (c.1808_1820delCCTCCTGCCGGGG S603Ffs*96) in one of the patients that has not been reported before. We also identified three other mutations (c.1933_1934del G p.G645Wfs*12, c.2047A>G p.T683A, c.1900_1922 delAGAGAGGCGGCCACCACTGCCAT  E635Rfs*15). ConclusionOur discovery of an ASXL1 mutation, a potential tumour suppressor gene, is a significant genetic aberration in CML. Our findings suggest that ASXL1 mutations are common in patients with late stages of the disease and imatinib therapy resistance.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"3 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139337893","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"ASSESSING THE ACCURACY OF FIB-4 SCORES TO POINT SHEAR WAVE ELASTOGRAPHY IN MONITORING DIFFERENT STAGES OF FIBROSIS IN NON-ALCOHOLIC LIVER DISEASE","authors":"S. Rasul","doi":"10.17656/jsmc.10420","DOIUrl":"https://doi.org/10.17656/jsmc.10420","url":null,"abstract":"BackgroundNon-alcoholic liver disease (NAFLD) assessment is done by measuring biochemical parameters from blood samples. However, non-invasive methods have gained significance lately. Biochemical parameters and staging of fibrosis-associated NAFLD based on the levels of biomarkers have been established procedures in the field. So, the utilization of non-invasive methods as a comparable means for fibrosis staging in NAFLD has yet to be established. ObjectivesTo compare the diagnostic performance of serum markers to point shear wave elastography for classifying fibrosis in NAFLD and its staging. Materials and MethodsData were collected by laboratory tests and point shear wave elastography. A comparison of FIB-4 indexes scores and point shear wave elastography for the staging of fibrosis in NAFLD was made based on cross-tabulation of the quantitative data obtained. ResultsA positive and significant correlation between FIB4 and age, ALT, AST, RBS, AST/ ALT, AST/ UL AST, APRI, AST/ Platelet count, and point shear wave elastography (PSWE). The correlation was negative and non-significant between FIB4 and Weight, Height, BMI, UL AST, TSB, and Platelet count. ConclusionThe study observed a positive correlation between FIB-4 and PSWE. Thus, the present study proposes the use of PSWE as a non-invasive diagnostic tool in the staging of fibrosis in NAFLD for patients with an intermediate FIB-4 score.","PeriodicalId":102216,"journal":{"name":"Journal of Sulaimani Medical College","volume":"22 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-09-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"139338127","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}