Annals of Hematology最新文献

{"title":"DGKα inhibition enhances the antitumor effect of chiauranib on transformed follicular lymphoma.","authors":"Jiewen Huang, Mengya Zhong, Jingwei Yao, Guangchao Pan, Qinwei Chen, Yating Liu, Yuelong Jiang, Yiming Luo, Jie Zha, Bing Xu","doi":"10.1007/s00277-025-06636-z","DOIUrl":"https://doi.org/10.1007/s00277-025-06636-z","url":null,"abstract":"<p><p>Transformed follicular lymphoma (t-FL) is a heterogeneous, aggressive B-cell malignancy with unfavorable clinical outcomes, while there is no standard and effective treatment available for t-FL. In this study, we investigated the preclinical anti-lymphoma efficacies and potential mechanism of action for a novel therapeutic strategy, combining the DGKα inhibitor ritanserin with chiauranib, a new orally bioavailable multi-target kinase inhibitor, in t-FL models. This combination therapy exhibited synergistic cytotoxicity against t-FL cells and primary B lymphoma cells, evidenced by cooperatively inducing loss of cell viability and promoting cell apoptosis. Moreover, the combination of ritanserin with chiauranib resulted in significant suppression of tumor burden in xenograft models. The synergistic lethality of ritanserin and chiauranib in t-FL was associated with the synergistic effect of these two medications on the inhibition of their respective targets. Of importance, the combined treatment was dual blockade of PI3K/AKT/mTOR and RAF/MEK/ERK pathways as well as vertical targeting of DGKα. Besides, downregulating the levels of c-Myc, BCL-xL and MCL-1 also contributed to the synergistic effects of the combined regimen on t-FL. Taken together, these findings suggest that the synergy between the DGKα inhibitor ritanserin and multi-targeted inhibitor chiauranib might represent a promising option for the treatment of t-FL.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-29","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145184525","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Epidemiology of chronic lymphocytic leukaemia in Germany: A retrospective analysis of administrative claims data.","authors":"Phillen Nozibuyiso Maqhuzu, Derya Bocuk, Sebastian Boelz, Sabrina Khageh Hosseini, Christian Leeb, Francois Renevey, Antje Mevius, Katja Greth, Konstantinos Christofyllakis","doi":"10.1007/s00277-025-06580-y","DOIUrl":"https://doi.org/10.1007/s00277-025-06580-y","url":null,"abstract":"<p><p>Chronic lymphocytic leukaemia (CLL), the most common leukaemia in Germany, remains incurable; despite the availability of several systemic treatment options, patients often experience multiple relapses. The aim of this retrospective, observational study was to generate real-world evidence on the epidemiology, patient characteristics and treatment patterns of CLL in Germany, focussing on covalent Bruton's tyrosine kinase inhibitor (cBTKi) and post-cBTKi treatments. Anonymised data from patients diagnosed with CLL (2012-2023) were harvested from one of the mandatory German Statutory Health Insurance sickness funds, AOK PLUS (the study population), and extrapolated to the German national population. There was an increase in CLL prevalence between 2012 and 2022, from 101.7 per 100,000 individuals (95% confidence interval [CI], 100.9-102.4) to 165.4 per 100,000 individuals (95% CI, 164.5-166.4), and incidence remained relatively stable in the German national population. One-third of the study population (n = 1616/4901) received treatment, and multiple treatment lines were common. Use of cBTKis (any line) increased between 2015 and 2022 in the German national population, from 2.4 per 100,000 individuals (95% CI, 2.3-2.5) to 15.7 per 100,000 individuals (95% CI, 15.4-16.0). Among 104 patients in the study population initiating post-cBTKi treatment, the most common (at any time) was another course of same/alternative cBTKi (53.8%), or anti-CD20 antibody (41.3%); 30.8% received venetoclax-based regimens at any time and 19.2% as a first post-cBTKi option. These real-world findings highlight the increasing prevalence of CLL in Germany, the need for multiple lines of treatment and the growing use of cBTKi therapies.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-29","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145184456","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Severity patterns and predictors of sickle cell anaemia among Gambian children: A cross-sectional analysis.","authors":"Lamin Makalo, Muhammed Manka, Orlianys Ruiz Perez, Sheikh Joof, Fatoumatta Jitteh, Musa Touray, Cessare Medri","doi":"10.1007/s00277-025-06625-2","DOIUrl":"https://doi.org/10.1007/s00277-025-06625-2","url":null,"abstract":"<p><p>Sickle cell anemia (SCA) remains a significant cause of morbidity and mortality in sub-Saharan Africa. In The Gambia, limited data exist on the clinical severity and predictors of disease burden in affected children. This study aimed to assess severity patterns and identify factors associated with disease severity among children with SCA using a validated clinical scoring system. A hospital-based cross-sectional study was conducted at the Pediatric Hematology Clinic of Edward Francis Small Teaching Hospital, Banjul. One hundred sixty-four children aged 1-18 years with confirmed HbSS were enrolled. Clinical and demographic data were collected using a structured proforma, and disease severity was assessed using the Adegoke and Kuti scoring system. Data were analyzed with SPSS version 20. Associations between severity and clinical variables were explored using chi-square tests, t-tests, and correlation analysis. Among the 164 participants, 67.1% had mild disease, 31.7% moderate, and 1.2% severe. The mean age was 8.43 ± 4.19 years, and the male-to-female ratio was 1.34:1. Gender was significantly associated with disease severity (P = 0.028). Early age at diagnosis showed a non-significant trend toward higher severity. Painful crises, hospitalizations, and blood transfusions were significantly associated with greater severity (P < 0.001). Laboratory markers such as low packed cell volume and elevated white blood cell counts also correlated with higher severity. Acute chest syndrome was the most frequent complication (34%). Children on hydroxyurea tended to have higher severity scores, reflecting that the medication was typically initiated in those with more severe disease. Most Gambian children with SCA in this cohort exhibited mild to moderate disease. Clinical severity was significantly associated with gender, frequency of complications, and select hematologic parameters. The findings underscore the need for early diagnosis through neonatal screening and improved access to hydroxyurea and comprehensive care. Further research into genetic modifiers may enhance individualized disease management in this setting.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-29","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145184426","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Genetic insights into myeloproliferative neoplasms and unusual sites thrombosis.","authors":"Erika Morsia, Paola Ranalli, Stefano Baldoni, Stefania Mancini, Sonia Morè, Chiara Cantò, Dorela Lame, Gaetano La Barba, Antonella Poloni, Serena Rupoli, Mauro Di lanni","doi":"10.1007/s00277-025-06606-5","DOIUrl":"10.1007/s00277-025-06606-5","url":null,"abstract":"<p><p>Myeloproliferative neoplasms (MPNs) are associated with an elevated risk of thrombosis in unusual sites such as the splanchnic vein thrombosis (SVT) and cerebral vein thrombosis (CVT). In patients with unusual site thrombosis, screening for MPNs is routine, but diagnosis is often difficult due to the absence of clear clinical signs or elevated blood counts-frequently leading to an MPN-U classification-while the thrombotic event itself is often the first clue. Furthermore, there is no consensus on treatments beyond anticoagulation, leading to variability across centers. This study investigates the molecular characteristics of MPNs associated with SVT and CVT. We conducted a retrospective, multicenter analysis of 44 patients with MPN and unusual site thrombosis from Italian hematology units, using next-generation sequencing. (NGS) to identify driver and passengers mutations. Our findings confirm a high prevalence of unclassifiable MPN (MPN-U) among SVT patients. JAK2 p.V617F was found in 86.4% of cases, and patients with additional mutations had higher median JAK2 variant allele frequencies. JAK2 p.V617F is known to promote thrombosis by inducing a pro-inflammatory endothelial environment, particularly relevant in low-flow venous sites such as cerebral sinuses and splanchnic veins, supporting MPN screening in these patients. In contrast, data on JAK2-unmutated cases are more limited, but our cohort suggests a possible association between unusual site thrombosis and a more complex mutational profile involving multiple genetic alterations. TET2 mutations were more frequent in patients with MPN-CVT compared to the rest of the cohort (66.6% vs. 15.7%). Absence of KIT mutations was associated with poorer thrombotic recurrence-free survival, suggesting a negative prognostic role of KIT mutation. Brief report.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-29","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145184483","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Treatment of transplantation-associated thrombotic microangiopathy with iptacopan: two cases report.","authors":"Jun Kong, Ze Tian, Dao-Xing Deng, Xiao-Dong Mo","doi":"10.1007/s00277-025-06591-9","DOIUrl":"https://doi.org/10.1007/s00277-025-06591-9","url":null,"abstract":"<p><p>Transplantation-associated thrombotic microangiopathy (TA-TMA) is a life-threatening complication of hematopoietic stem cell transplantation (HSCT). With mortality rates up to 90% without timely treatment, effective management remains a challenge. Complement dysregulation plays a central role in TA-TMA pathogenesis. We reported two TA-TMA cases successfully treated with iptacopan, a factor B inhibitor targeting the alternative pathway. A 40-year-old male with early T-cell precursor acute lymphoblastic leukemia developed early-onset TA-TMA post-HSCT, and a 41-year-old female with acute myeloid leukemia arising from previous myelodysplastic syndrome developed delayed-onset TA-TMA after allo-HSCT. Iptacopan administration led to significant clinical and biochemical recovery in both two patients. These two cases highlight iptacopan's potential as an effective therapy for TA-TMA.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-29","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145184539","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Clinical outcome and immunophenotype of axicabtagene ciloleucel (axi-cel) and relmacabtagene autoleucel (relma-cel) in relapsed/refractory large B-Cell lymphoma on Chinese population: a single-center experience.","authors":"Danqing Zhao, Jing Ruan, Chong Wei, Yan Zhang, Daobin Zhou, Wei Zhang","doi":"10.1007/s00277-025-06541-5","DOIUrl":"https://doi.org/10.1007/s00277-025-06541-5","url":null,"abstract":"<p><strong>Background: </strong>Chimeric antigen receptor (CAR) T-cell therapy targeting CD19 has shown remarkable efficacy for treating relapsed or refractory (r/r) large B-cell lymphomas, leading to the approval of axicabtagene ciloleucel (axi-cel) and relmacabtagene autoleucel (relma-cel) in China. Despite these advances, limited real-world data exist for CAR-T therapies in Asian populations, and comparative outcomes between axi-cel and relma-cel remain understudied.</p><p><strong>Methods: </strong>This retrospective cohort study analyzed real-world efficacy and safety data for commercial CD19 CAR-T therapies in 33 patients with r/r large B-cell lymphoma treated at a tertiary hospital in China. Baseline demographics, International Prognostic Index (IPI) scores, performance status, and genetic profiles were collected. Additionally, T-cell immunophenotypes were assessed in a subset of patients pre- and post-CAR-T manufacturing to evaluate potential associations with clinical outcomes. Clinical responses were measured using PET/CT, and survival was analyzed via Kaplan-Meier methods.</p><p><strong>Results: </strong>Among the 33 patients (median age 53), 76.7% achieved a complete response (CR) three months post-CAR-T infusion. One-year overall survival (OS) was 72.3%, and the one-year progression-free survival (PFS) was 71.2%. T-cell phenotype analysis revealed no significant association between initial T-cell subsets and final CAR-T product characteristics. Axi-cel demonstrated a higher CR rate (100%) compared to relma-cel (61.1%) but was associated with more severe cytokine release syndrome (CRS). Patients with a higher proportion of stem-like memory T cells (CCR7 + CD45RA+) in the relma-cel product exhibited reduced efficacy, suggesting an optimal range of stem-like memory cell proportions for therapeutic benefit.</p><p><strong>Conclusion: </strong>In this cohort, CAR-T therapies for r/r large B-cell lymphoma yielded high response rates and promising survival outcomes, with axi-cel showing superior efficacy but higher CRS incidence compared to relma-cel. The study highlights the need for optimal stem-like memory T-cell proportions in CAR-T products for improved efficacy. Prospective multicenter studies are warranted to confirm these findings in larger patient populations.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145147735","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Haploidentical hematopoietic stem cell transplantation for the treatment of congenital dyserythropoietic anemia combined with thalassemia: a report of two cases.","authors":"Changyu Yang, Jian Huang, Kun Yang, Changqing Wei, Lina Lu, Dongmei Liu, Beibei Yang, Guiping Liao, Xiaolin Yin, Yali Zhou","doi":"10.1007/s00277-025-06615-4","DOIUrl":"https://doi.org/10.1007/s00277-025-06615-4","url":null,"abstract":"<p><p>Congenital dyserythropoietic anemia (CDA) represents a heterogeneous group of rare hereditary disorders characterized by ineffective erythropoiesis and often presents with clinical features that overlap with thalassemia. Hematopoietic stem cell transplantation (HSCT) remains the only definitive curative intervention for CDA; however, the application of haploidentical HSCT in this context is limited and presents considerable challenges. Herein, we report two pediatric cases of CDA coexisting with thalassemia who underwent haploidentical related donor HSCT utilizing a novel conditioning regimen comprising three alkylating agents. Graft-versus-host disease (GVHD) prophylaxis was achieved using. posttransplant cyclophosphamide and anti-thymocyte globulin. Both patients attained sustained engraftment, transfusion independence, and remained free from severe transplant-related complications. These cases illustrate the feasibility and therapeutic potential of haploidentical HSCT for CDA, even in. the presence of concomitant thalassemia.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145147758","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Outcome and response to different management regimens in pediatric patients with immune thrombocytopenia (ITP).","authors":"Rasha AbdelRaouf AbdelAziz, Dalia El-Sayed, Fatma El Zahraa Ahmed, Mohammed Al Komy","doi":"10.1007/s00277-025-06626-1","DOIUrl":"https://doi.org/10.1007/s00277-025-06626-1","url":null,"abstract":"<p><p>Immune thrombocytopenia (ITP) is the most common acquired bleeding disorder in children and a frequent source of clinical concern. This study aimed to evaluate the clinical outcomes and treatment responses to different therapeutic lines. This observational study included 90 children with newly diagnosed ITP who were registered and followed at Cairo University Children's Hospital between June 2022 and December 2023. The study cohort consisted of 40 males (44.4%) and 50 females (55.6%), with a mean age of 5.3 years. The mean platelet count at presentation was 9.9 ± 11.9 × 10⁹/L, increasing to 384.6 ± 141.0 × 10⁹/L at six months post-treatment. Six patients (5.8%) experienced spontaneous recovery without treatment, while 84 patients (94.2%) received therapeutic interventions including corticosteroids or intravenous immunoglobulin (IVIG). By three months, 61 patients (68.9%) had responded to treatment, while 29 patients (32.2%) required second-line therapy with thrombopoietin receptor agonists (TPO-RAs). Corticosteroids remain the cornerstone of first-line therapy in newly diagnosed pediatric ITP. Patients who do not respond to initial treatment or experience relapse demonstrate favorable outcomes with TPO-RA therapy.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145147796","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Development and validation of deep vein thrombosis diagnostic model based on machine learning methods.","authors":"Bin Yan, Haijun Guo, Tianxi Hu, Yu Zhang, Zhixin Zheng, Weipeng Du, Yuhan Gu","doi":"10.1007/s00277-025-06628-z","DOIUrl":"https://doi.org/10.1007/s00277-025-06628-z","url":null,"abstract":"<p><p>The D-Dimer testing has limited diagnostic value for patients with a deep venous thrombosis (DVT) probability based on clinical prediction rules. There are still patients with normal D-Dimer levels (< 500 ng/mL) diagnosed with DVT. Some new predictive marker may improve the predictive power of D-Dimer, especially in DVT patients with normal levels of D-Dimer. All subjects were from Nanyang Central Hospital. The demographic data and laboratory test data were collected. Multiple models were used to evaluate and calculate the importance rank. Multivariate logistics was used to establish a DVT diagnostic model. Compared to D-Dimer and other markers, this combined model has better performance. The von Willebrand factor Gain-of-function mutant GPIb binding assays (VWF: GPIbM) can improve the diagnostic capability of D-Dimer, which has higher diagnostic value and clinical benefits. In addition, the model still has good diagnostic capability in DVT patients with normal D-Dimer levels. The combined model has better diagnostic performance than D-Dimer, and it is valuable for some patients whose clinical prediction rules cannot be evaluated due to difficulties in obtaining medical history information. VWF: GPIbM can be used to assist in the diagnosis of DVT in the future.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145147801","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Identification of a novel PML exon 6 splice variant in atypical PML::RARα transcripts in acute promyelocytic leukemia.","authors":"Haimin Chen, Meihong Chen, Zhongjie Yang, Shuzhen Liao, Yun Lin, Linlin Yan","doi":"10.1007/s00277-025-06613-6","DOIUrl":"https://doi.org/10.1007/s00277-025-06613-6","url":null,"abstract":"<p><p>The PML::RARα fusion gene resulting from the t(15;17) chromosomal translocation serves as the pathognomonic molecular marker of acute promyelocytic leukemia (APL), which has been shown to directly repress transcription of retinoic acid (RA)-responsive genes, ultimately inducing granulocytic differentiation arrest. In this study, we report an APL case harboring an atypical PML::RARα fusion transcript characterized by a novel splice site variant (GCCaggccc) within PML exon 6, resulting in an 80 base pairs deletion of the distal exonic sequence with concomitant insertion of 23 exogenous nucleotides (agagccttcttctctctgggacaag). To our knowledge, this isoform differs from all previously described PML::RARα fusion transcripts. This case emphasizes the importance of molecular characterization in APL diagnosis and minimal residual disease (MRD) monitoring, though further studies are required to establish its clinical correlation.</p>","PeriodicalId":8068,"journal":{"name":"Annals of Hematology","volume":" ","pages":""},"PeriodicalIF":2.4,"publicationDate":"2025-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145147821","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":3,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}