Identification of a novel PML exon 6 splice variant in atypical PML::RARα transcripts in acute promyelocytic leukemia.

The PML::RARα fusion gene resulting from the t(15;17) chromosomal translocation serves as the pathognomonic molecular marker of acute promyelocytic leukemia (APL), which has been shown to directly repress transcription of retinoic acid (RA)-responsive genes, ultimately inducing granulocytic differentiation arrest. In this study, we report an APL case harboring an atypical PML::RARα fusion transcript characterized by a novel splice site variant (GCCaggccc) within PML exon 6, resulting in an 80 base pairs deletion of the distal exonic sequence with concomitant insertion of 23 exogenous nucleotides (agagccttcttctctctgggacaag). To our knowledge, this isoform differs from all previously described PML::RARα fusion transcripts. This case emphasizes the importance of molecular characterization in APL diagnosis and minimal residual disease (MRD) monitoring, though further studies are required to establish its clinical correlation.