Clinical and Experimental Pharmacology and Physiology最新文献

{"title":"Ddx17 Mitigates Sepsis-Induced Cardiomyopathy by Regulating Mitochondrial Dynamics in Cardiomyocytes","authors":"Ya-ting Jiang,&nbsp;Li-ran Su,&nbsp;Fang-jing Ni,&nbsp;Luo-ye Lu,&nbsp;Yu-qiang Gong,&nbsp;Jun Luo,&nbsp;Chen-xi Shen,&nbsp;Yang Cao","doi":"10.1111/1440-1681.70105","DOIUrl":"10.1111/1440-1681.70105","url":null,"abstract":"<div>\u0000 \u0000 <p>Sepsis-induced cardiomyopathy (SICM) is a severe complication of sepsis, in which mitochondrial dysfunction contributes to poor outcomes. DEAD-box helicase 17 (Ddx17), a member of the DEAD-box RNA helicase family, is known to regulate mitochondrial function, but its role in SICM remains unclear. In this study, mice with cardiomyocyte-specific Ddx17 knockdown (Ddx17-cKD) and overexpression (Ddx17-OE) were generated, and sepsis models were established using cecal ligation and puncture. Mechanistic findings were further validated in vitro using immunoprecipitation and dual-luciferase assays. Ddx17 expression was markedly reduced in the cardiac tissues of septic mice and in lipopolysaccharide-treated cardiomyocytes. Knockdown of Ddx17 increased mitochondrial reactive oxygen species accumulation, enhanced cell death and decreased superoxide dismutase activity. In contrast, Ddx17 overexpression attenuated mitochondrial apoptosis and oxidative stress, restored adenosine triphosphate production and mitochondrial membrane potential and improved cardiac function in septic mice. Mechanistically, Ddx17 interacted with signal transducer and activator of transcription 3 (STAT3) to suppress transcription of the mitochondrial fission protein dynamin-related protein 1 while maintaining the level of the fusion protein mitofusin 1, thereby preserving mitochondrial integrity and cardiomyocyte homeostasis. These findings demonstrate that Ddx17 protects against sepsis-induced cardiomyopathy by regulating mitochondrial dynamics, reducing oxidative stress and preventing apoptosis, thereby highlighting Ddx17 as a potential therapeutic target for septic cardiac dysfunction.</p>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 2","pages":""},"PeriodicalIF":2.5,"publicationDate":"2026-02-08","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"146141133","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Kruppel-Like Factor 5 Modulates the Nuclear Factor Erythroid-2-Related Factor 2/Heme Oxygenase 1 Signalling Pathway to Regulate Vascular Smooth Muscle Cell Ferroptosis in Abdominal Aortic Aneurysm","authors":"Guangwei Yang,&nbsp;Cong Yu,&nbsp;Chao Weng","doi":"10.1111/1440-1681.70110","DOIUrl":"10.1111/1440-1681.70110","url":null,"abstract":"<div>\u0000 \u0000 \u0000 <section>\u0000 \u0000 <h3> Objective</h3>\u0000 \u0000 <p>Abdominal aortic aneurysm (AAA) refers to a disease where the abdominal aorta progressively dilates to 3.0 cm or more, making it prone to rupture. The etiologic and pathophysiological mechanisms underlying the formation and development of AAA are not yet fully understood. A preliminary investigation was conducted into the effects of Kruppel-like factor 5 (KLF5) regulation of the nuclear factor erythroid-2-related factor 2/heme oxygenase 1 (NRF2/HO-1) signalling pathway on ferroptosis in AAA vascular smooth muscle cells (VSMCs).</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Methods</h3>\u0000 \u0000 <p>ApoE^−/− mice or primary VSMCs were induced with angiotensin II (Ang II). KLF5 overexpression was achieved through adenovirus injection in the mouse model, and ML385 (NFR2 inhibitor) was injected to explore the involvement of the NRF2/HO-1 pathway in KLF5-regulated ferroptosis, inflammation, phenotypic switching and calcium deposition. Ang II-treated VSMCs were transiently transfected to overexpress KLF5 and/or incubated with Erastin (ferroptosis inducer) or ML385. The abdominal aorta was sampled from AAA model mice, and VSMC supernatants were collected to perform functional assays.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Results</h3>\u0000 \u0000 <p>KLF5 expression was downregulated in abdominal aorta tissues from AAA mice. KLF5 overexpression ameliorated inflammatory response by reducing phenotypic switching in VSMCs and inhibited ferroptosis and vascular calcification by reducing oxidative stress. Induction of ferroptosis partially reversed the ameliorative effect of KLF5 on vascular calcification in VSMCs. KLF5 exerted antioxidant effects by increasing NRF2 nuclear translocation and upregulating HO-1. Inhibition of the NRF2/HO-1 pathway partially reversed KLF5 regulation of phenotypic switching and vascular calcification in VSMCs.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Conclusion</h3>\u0000 \u0000 <p>KLF5 may exert a protective effect by inhibiting ferroptosis and calcium deposition in VSMCs in AAA through regulation of the NRF2/HO-1 signalling pathway.</p>\u0000 </section>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 2","pages":""},"PeriodicalIF":2.5,"publicationDate":"2026-02-08","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"146141168","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Correction to “Caffeic Acid Phenethyl Ester Ameliorates Colistin-Induced Nephrotoxicity in Rats via Modulation of FOXO1/Nrf2/Sirt1 Axis”","authors":"","doi":"10.1111/1440-1681.70102","DOIUrl":"10.1111/1440-1681.70102","url":null,"abstract":"<p>M. Z. Nasrullah, T. Neamtalllah, M. Alshibani, et al., “Caffeic Acid Phenethyl Ester Ameliorates Colistin-Induced Nephrotoxicity in Rats via Modulation of FOXO1/Nrf2/Sirt1 Axis,” <i>Clinical and Experimental Pharmacology and Physiology</i> 51, no. 12 (2024): e70000, https://doi.org/10.1111/1440-1681.70000.</p><p>In Table 2, the forward sequence of β-Actin 5′AAAGCACATCCAATAAAAAGC was incorrect.</p><p>It should be corrected to the following: 5′TCCGTCGCCGGTCCACACCC.</p><p>In the abstract, under the methods, ‘group 3 received Cst IP’ is incomplete. It should be corrected to ‘group 3 received Cst (1000 000 IU/Kg) IP’.</p><p>The authors apologise for these oversights and for the inconvenience they may have caused.</p>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 2","pages":""},"PeriodicalIF":2.5,"publicationDate":"2026-01-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://onlinelibrary.wiley.com/doi/epdf/10.1111/1440-1681.70102","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"146017624","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Effect and Mechanism of Shenqi Lixin Formula on Angiogenesis and Glucose Metabolism in Rats With Heart Failure After Myocardial Infarction","authors":"Jiaqi Liu,&nbsp;Qili Zhao,&nbsp;Hezhan Wang,&nbsp;Yanbo Sui","doi":"10.1111/1440-1681.70100","DOIUrl":"10.1111/1440-1681.70100","url":null,"abstract":"<div>\u0000 \u0000 <p>Post-myocardial infarction (MI) patients remain at high risk for developing heart failure (HF). This study investigated the therapeutic effects and mechanistic basis of Shenqi Lixin Formula (SQLXF) on angiogenesis and glucose metabolism in MI-HF. MI-HF rat models were generated, and myocardial pathology, infarct area, cardiac function, platelet endothelial cell adhesion molecule-1 (CD31), vascular endothelial growth factor A (VEGFA), hexokinase 2 (HK2), lactate dehydrogenase A (LDHA), lysine demethylase 5B (KDM5B) and ER degradation enhancing alpha-mannosidase like protein 3 (EDEM3) expressions, glucose consumption, lactate production and extracellular acidification rate (ECAR) were evaluated. Hypoxia-treated human cardiac microvascular endothelial cells (HCMECs) were used as in vitro models to assess angiogenic capacity. SQLXF intervention and subsequent analyses were performed to determine KDM5B and EDEM3 expression levels, as well as the enrichment of KDM5B and trimethylation of lysine 4 on histone H3 protein subunit (H3K4me3) on the EDEM3 promoter. In animal models, infarct area enlargement, impaired cardiac function, increased glucose consumption, lactate production, and upregulation of CD31, VEGFA, HK2, LDHA and KDM5B expressions were observed, accompanied by reduced EDEM3 expression. SQLXF administration improved cardiac function, promoted angiogenesis, normalised glucose metabolism, inhibited KDM5B and restored EDEM3 expression. In HCMECs, hypoxia suppressed EDEM3, angiogenesis and metabolic stability while increasing KDM5B expression; these alterations were reversed by high-dose SQLXF. Mechanistically, KDM5B inhibited EDEM3 transcription by reducing H3K4me3 enrichment, whereas SQLXF enhanced H3K4me3 and relieved KDM5B-mediated repression. KDM5B overexpression or EDEM3 knockdown attenuated the beneficial effects of SQLXF.</p>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 1","pages":""},"PeriodicalIF":2.5,"publicationDate":"2026-01-14","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145984555","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Tabersonine Alleviates Cerebral Ischemia/Reperfusion Injury Partly via Repressing the SLC6A2/NF-κB Signalling Pathway","authors":"Li Zhang,&nbsp;Liji Chen,&nbsp;Juhua Chen,&nbsp;Xuehua Ge,&nbsp;Yingchun Yu,&nbsp;Panpan Sun,&nbsp;Yonglan Ruan","doi":"10.1111/1440-1681.70101","DOIUrl":"10.1111/1440-1681.70101","url":null,"abstract":"<div>\u0000 \u0000 <p>The study aimed to investigate the neuroprotective functions and the underlying regulatory mechanisms of Tabersonine in cerebral ischemia/reperfusion (I/R) injury. Oxygen–glucose deprivation/reoxygenation (OGD/R)-treated neural cells were used as a cell model under I/R context. Cell counting kit 8 (CCK8) assay and enzyme-linked immunosorbent assay (ELISA) were used to assess the cell viability and the release levels of inflammatory cytokines (interleukin-1β (IL-1β), IL-6 and tumour necrosis factor α (TNF-α)) of treated neural cells. The apoptotic proportions of treated neural cells were analysed by flow cytometry, and the intracellular levels of reactive oxygen species (ROS) and superoxide dismutase (SOD) were quantified by corresponding kits. In this study, molecular docking analysis identified solute carrier family 6 member 2 (SLC6A2) as a potential target of Tabersonine in cerebral infarction, demonstrating a high binding affinity of −7.4 kcal/mol. Tabersonine treatment increased neural cell viability, repressed apoptosis and reduced the release levels of IL-1β, IL-6 and TNF-α under OGD/R stress. Moreover, Tabersonine treatment reduced ROS levels and increased SOD expression in neural cells under OGD/R treatment. In contrast to the protective effect of SLC6A2 knockdown, its overexpression counteracted the neuroprotection conferred by Tabersonine. Tabersonine also inactivated the NF-κB pathway partially via SLC6A2. Furthermore, Tabersonine pretreatment demonstrated significant neuroprotective effects in MCAO/R rats, as evidenced by reduced brain edema and attenuated neural inflammation and apoptosis. In conclusion, Tabersonine can alleviate neural impairment in cerebral I/R injury partially by inactivating the NF-κB pathway through SLC6A2.</p>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 1","pages":""},"PeriodicalIF":2.5,"publicationDate":"2026-01-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145905874","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Cellular Pharmacology of Bupivacaine in Lung Fibroblasts: Role of Intracellular Calcium Signalling and Chelation","authors":"Wei-Zhe Liang,&nbsp;Gwo-Ching Sun","doi":"10.1111/1440-1681.70078","DOIUrl":"10.1111/1440-1681.70078","url":null,"abstract":"<div>\u0000 \u0000 <p>Bupivacaine, a commonly used aminoamide local anaesthetic, exerts cellular effects beyond anaesthesia. However, its effects on calcium (Ca²⁺) signalling and the physiological responses of lung fibroblasts remain insufficiently characterised. This study aimed to determine whether bupivacaine disrupts intracellular Ca²⁺ homeostasis and induces cytotoxicity in IMR-90 human foetal lung fibroblasts via Ca²⁺-dependent mechanisms. Cell viability was assessed using the CCK-8 assay, and intracellular Ca²⁺ levels ([Ca²⁺]ᵢ) were monitored in fura-2-loaded cells. Pharmacological inhibitors were used to dissect the signalling pathways involved. Bupivacaine (20–60 μM) caused a concentration-dependent rise in [Ca²⁺]ᵢ and a corresponding decline in cell viability. These effects were significantly attenuated by pre-treatment with the Ca²⁺ chelator BAPTA-AM, indicating a Ca²⁺-dependent cytotoxic mechanism. Mechanistically, bupivacaine induced Ca²⁺ influx through store-operated Ca²⁺ entry (SOCE), involving protein kinase C (PKC), and triggered Ca²⁺ release from the endoplasmic reticulum (ER) via a phospholipase C (PLC)-dependent pathway. Mn²⁺ quenching assays confirmed SOCE as the primary route of Ca²⁺ entry. Bupivacaine disrupts Ca²⁺ signalling through both extracellular influx and intracellular release, contributing to pulmonary cytotoxicity. These findings underscore the relevance of Ca²⁺ homeostasis in anaesthetic-related lung injury and suggest that Ca²⁺ chelation may be a potential protective strategy.</p>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 1","pages":""},"PeriodicalIF":2.5,"publicationDate":"2025-12-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145862307","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"METTL3-Mediated m6A Modification Facilitates pri-miR-221 Maturation to Regulate Macrophage M1/M2 Polarisation and Immune Inflammation in Rheumatoid Arthritis","authors":"Xiangping Gong,&nbsp;Wei Li,&nbsp;Xiaohui Wu,&nbsp;Lirong Mao","doi":"10.1111/1440-1681.70099","DOIUrl":"10.1111/1440-1681.70099","url":null,"abstract":"<div>\u0000 \u0000 \u0000 <section>\u0000 \u0000 <h3> Objective</h3>\u0000 \u0000 <p>Rheumatoid arthritis (RA) pathogenesis involves dysregulated macrophage polarisation, yet the epigenetic mechanisms governing this process remain poorly understood. This study investigates how METTL3 promotes pri-miR-221 maturation via m6A modification to regulate macrophage M1/M2 polarisation and immune inflammation in RA.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Methods</h3>\u0000 \u0000 <p>METTL3 mRNA levels in serum from RA patients and healthy controls were detected by RT-qPCR and their correlations with C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) were analysed. Peripheral blood mononuclear cells (PBMCs) were isolated, differentiated into macrophages and assessed for METTL3 expression using RT-qPCR and Western blot. M1/M2 polarisation was evaluated via marker genes (iNOS, Arg-1) and released cytokines (IL-6, TNF-α for M1; TGF-β1, IL-10 for M2) using Western blot and ELISA, and verified by immunofluorescence (CD68+/CD86+ for M1; CD68+/CD206+ for M2). Methylated RNA immunoprecipitation and RNA stability assays were used to identify METTL3-mediated m6A modification of pri-miR-221, while RNA immunoprecipitation was conducted to confirm YTHDF1/2/3-pri-miR-221 interactions. In vivo, a rat RA model was established, with METTL3 expression and ankle pathology analysed via immunohistochemistry, haematoxylin–eosin and Safranin O-fast green staining.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Results</h3>\u0000 \u0000 <p>METTL3 was significantly upregulated in RA serum, isolated PBMCs and derived macrophages, positively correlating with CRP and ESR. METTL3 knockdown in macrophages reduced M1 markers and increased M2 markers, indicating METTL3 knockdown promoted M2 polarisation and inhibited M1 polarisation. METTL3 stabilised pri-miR-221 via m6A, and pri-miR-221 overexpression reversed the effect of METTL3 knockdown on M2 polarisation. In RA rats, METTL3 was elevated, exacerbating ankle joint destruction.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Conclusion</h3>\u0000 \u0000 <p>METTL3 knockdown suppresses m6A-dependent pri-miR-221 maturation, rebalancing macrophage polarisation and attenuating ankle joint destruction in RA.</p>\u0000 </section>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 1","pages":""},"PeriodicalIF":2.5,"publicationDate":"2025-12-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145803325","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Bharangin, A Diterpenoid, Enhances the Sensitivity of Pancreatic Cancer Cells to Gemcitabine Through Involvement of Long Non-Coding RNAs and Nuclear Factor-κB","authors":"Nikee Awasthee,&nbsp;Anusmita Shekher,&nbsp;Ankit Srivastava,&nbsp;Subash Chandra Gupta","doi":"10.1111/1440-1681.70097","DOIUrl":"10.1111/1440-1681.70097","url":null,"abstract":"<div>\u0000 \u0000 <p>Pancreatic cancer (PaCa) manifests as an aggressive tumour due to the late occurrence of early symptoms. The overall 5-year survival rate of PaCa is merely 2%–9%. Bharangin (BG), a diterpenoid quinonemethide known for its anti-cancer activities, was investigated in a preclinical PaCa model. A dose- and time-dependent suppression in the viability of PaCa cells was observed by BG. The diterpenoid suppressed the level of tumorigenic proteins in PaCa cells. As evident from phosphatidylserine externalisation, acridine orange (AO)/propidium iodide (PI) staining, cell cycle analysis and DNA laddering, BG was found to induce apoptosis in PaCa cells. An accumulation in the sub-G1 population was observed by BG. The diterpenoid induced depolarization in the mitochondrial membrane potential and enhanced the PaCa cells' sensitivity to gemcitabine (GEM). The cancer-associated lncRNAs were also modulated by both BG and GEM in PaCa cells. BG also suppressed the p65 nuclear translocation induced by TNF-α in PaCa cells. Overall, BG exhibits activities in PaCa cells. The suppression of NF-κB activation and the modulation of lncRNAs expression may provide a basis for further exploration of BG as a therapeutic agent in PaCa.</p>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 1","pages":""},"PeriodicalIF":2.5,"publicationDate":"2025-12-08","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145707607","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"COX17 Attenuates Diabetes-Associated Retinal Injury by Improving Mitochondrial Function","authors":"Hai-Yan Lian,&nbsp;Zhen-De Deng,&nbsp;Ming Yan,&nbsp;Zhen Huang,&nbsp;Ya Ye,&nbsp;Yan-Ping Song","doi":"10.1111/1440-1681.70098","DOIUrl":"10.1111/1440-1681.70098","url":null,"abstract":"<div>\u0000 \u0000 \u0000 <section>\u0000 \u0000 <h3> Purpose</h3>\u0000 \u0000 <p>Diabetic retinopathy (DR), a common complication of diabetes, is a leading cause of blindness globally. Cytochrome C oxidase copper chaperone (COX17) is important for Cytochrome C oxidase assembly, and COX17 overexpression is reported to improve mitochondrial function in renal tissue. This study aimed to explore whether COX17 alleviated DR by regulating mitochondrial function.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Methods</h3>\u0000 \u0000 <p>Diabetes was induced in rats by a single intraperitoneal injection of 65 mg/kg streptozotocin (STZ). Overexpression of COX17 was performed by infection of adeno-associated virus into the vitreous body of rats 2 weeks after STZ injection. Human retinal microvascular endothelial cells (HRMECs) were cultured with high-glucose (HG) medium (20 mM <span>d</span>-glucose). Immunofluorescence assay, enzymatic histochemistry assay, CCK-8 assay, DCFH-DA staining, flow cytometry, western blot, and real-time PCR were performed.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Results</h3>\u0000 \u0000 <p>COX17 expression was decreased in the retinal tissues of diabetic rats and HG-stimulated HRMECs. COX17 overexpression alleviated retinal neovascularisation and increased retinal thickness in diabetic rats. COX17 overexpression decreased ROS and apoptosis and increased Cytochrome C oxidase activity, mtDNA copy number, ATP content, and mitochondrial membrane potential (MMP) in both the retinal tissues of diabetic rats and HG-induced HRMECs. Overexpression of COX17 effectively reduced cell apoptosis and increased cell viability. Overexpression of COX17 increased mtDNA in HG-induced HRMECs.</p>\u0000 </section>\u0000 \u0000 <section>\u0000 \u0000 <h3> Conclusions</h3>\u0000 \u0000 <p>Overall, our study suggested that COX17 overexpression exerted protective effects in the retinas of diabetic rats and in HRMECs by stabilising mitochondrial function.</p>\u0000 </section>\u0000 </div>","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 1","pages":""},"PeriodicalIF":2.5,"publicationDate":"2025-12-05","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145676550","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Esculin Facilitates Aerobic Glycolysis via the Wnt/β-Catenin/HIF-1α Pathway to Reduce the Progression of Gastric Cancer","authors":"Qing Shang,&nbsp;Jing Wang,&nbsp;Xiaolei Wang,&nbsp;Haipeng Wang","doi":"10.1111/1440-1681.70096","DOIUrl":"10.1111/1440-1681.70096","url":null,"abstract":"&lt;div&gt;\u0000 \u0000 \u0000 &lt;section&gt;\u0000 \u0000 &lt;h3&gt; Background&lt;/h3&gt;\u0000 \u0000 &lt;p&gt;Gastric cancer (GC) is a complex pathogenesis closely related to various signalling pathways. Esculin, as a natural compound, possesses anti-oxidation, anti-inflammatory, and anti-tumour influences, and has shown promising application prospects in research on colorectal cancer (CRC) and others. However, the specific impact of Esculin on GC remains unclear. This article explores the action mechanism of Esculin in gastric cancer, which not only helps to understand its anti-cancer properties but may also offer novel approaches and strategies for treating GC.&lt;/p&gt;\u0000 &lt;/section&gt;\u0000 \u0000 &lt;section&gt;\u0000 \u0000 &lt;h3&gt; Methods&lt;/h3&gt;\u0000 \u0000 &lt;p&gt;Using the CCK-8 method to screen the concentration of Esculin that does not affect the viability of normal gastric mucosal cells GES-1. At this concentration, the changes in viability, proliferation level, migration ability, invasion ability, and apoptosis level of HGC-27 and AGS were measured. The levels of related proteins were detected through Western blot. Subsequent use of the glycolysis inhibitor 3-BrPA, the Wnt signalling pathway activator SKL2001, and the inhibitor LiCl interfered with GC cells. The impact of Esculin on aerobic glycolysis in cells was assessed by measuring glucose uptake levels, pyruvate production levels, lactate generation levels, ATP production levels, and extracellular acidification rate (ECAR). The regulatory effect of Esculin on the Wnt/β-catenin/HIF-1α pathway was evaluated through immunofluorescence and Western blot. Injecting HGC-27 cells to build a xenograft tumour model and evaluating the effect of Esculin gavage on tumour growth in mice.&lt;/p&gt;\u0000 &lt;/section&gt;\u0000 \u0000 &lt;section&gt;\u0000 \u0000 &lt;h3&gt; Results&lt;/h3&gt;\u0000 \u0000 &lt;p&gt;Esculin at concentrations of 0, 20, 40, and 80 μM is non-toxic to GES-1. An increase in the concentration of Esculin correlates with a continuous decline in the viability of four GC cell lines, with GC cells showing the highest significance. The levels of proliferation, migration, and invasion in both cell lines significantly decrease with increasing concentrations of Esculin, while the apoptosis rate significantly increases. 80 μM of Esculin can significantly inhibit glucose absorption, pyruvate production, lactate, and ATP generation in cells, leading to a significant decrease in ECAR; at the same time, it significantly inhibits the expression of proteins in the Wnt/β-catenin/HIF-1α signalling pathway. Administering 20 mg/kg of Esculin by gavage can significantly suppress tumour growth in mice, concurrently leading to a reduction of proteins associated with the Wnt/β-catenin/HIF-1α pathway within the tumour tissue.&lt;/p&gt;\u0000 &lt;/section&gt;\u0000 \u0000 &lt;section&gt;\u0000 \u0000 &lt;h3&gt; Conclusion&lt;/h3&gt;\u0000 \u0000 &lt;p&gt;Esculin inhibit","PeriodicalId":50684,"journal":{"name":"Clinical and Experimental Pharmacology and Physiology","volume":"53 1","pages":""},"PeriodicalIF":2.5,"publicationDate":"2025-12-03","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"145667250","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}