S. Triyono, Andini Prima, Oktafri Rahman, M. Telaumbanua, Agus Haryanto, Ahmad Tusi
{"title":"Cooling the high temperature nutrition solution to improve growth, yield and water productivity of hydroponic red lettuce (Lactuca sativa L Var Red rapids) in a tropical location","authors":"S. Triyono, Andini Prima, Oktafri Rahman, M. Telaumbanua, Agus Haryanto, Ahmad Tusi","doi":"10.30574/wjarr.2024.23.1.2016","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2016","url":null,"abstract":"Red lettuce is preferred because of its high nutritional, vitamin, and antioxidant contents. Hydroponic cultivation has been known to successfully improve the quality and productivity of red lettuce. But the efforts to increase the productivity of hydroponic red lettuce face constraints of high temperatures in the tropics. The aim of this study was to compare the growth, yield, and water productivity of red lettuce in three hydroponic systems namely wick, floating raft, and dry systems by controlling the temperature of the nutrient solutions using protected nutrient containers. The experimental design of randomized complete block split plots with the main plots of the nutrient containers which consisted of three levels: Refrigerated container, styrofoam-insulated container, and bare bucket container in which the nutrient solution was delivered to plants in three separated gutters as the cultivation beds, then recirculated back to the corresponding nutrient container. The secondary plot is hydroponic systems including three systems namely wick, floating raft, and dry systems. The blocks were the arrangement of plants according to the flow direction of the nutrient solution, namely upstream, middle and downstream in each gutter. Each experimental unit was represented by 3 plants. Data sets were analyzed by using analysis of variance and followed by LSD multiple comparisons at the 5% level. The results showed that the temperature of the nutrient solution controlled by the three containers had a significant effect on all observed plant parameters. Meanwhile, the hydroponic systems and the blocks had no significant effect. The use of Refrigerated container showed the best performance in improving the growth, yield, and water productivity of the red lettuce.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141795872","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"The Correlation between the knowledge and attitudes of mothers of toddlers about immunization with compliance to complete routine immunization in Wage Village, Taman Subdistrict, Sidoarjo Regency, East Java, Indonesia","authors":"Dahlia Febrica Sawitri, Lilik Djuari, Astika Gita Ningrum, Euvanggelia Dwilda F","doi":"10.30574/wjarr.2024.23.1.2028","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2028","url":null,"abstract":"Introduction: The under-five mortality rate in Indonesia and East Java in 2021 shows a downward trend from 2020, with the main cause of under-five mortality being infectious diseases such as pneumonia and diarrhea. One of the factors that contributed to this was the increase in complete immunization coverage for babies in previous years; however, in the 2021 and 2022 periods in Indonesia and East Java, there was a significant decline in the number of complete immunization coverage. Community behaviour regarding improving health, in this case, immunization, is determined by many factors, one of which is the knowledge and attitudes of the mothers of toddlers themselves. Objective: Analyzing the correlation between the knowledge and attitudes of mothers of toddlers regarding immunization and compliance with providing complete routine immunization in Wage Village, Taman District, Sidoarjo Regency, East Java, Indonesia. Method: This research used quantitative methods with a cross-sectional approach. Data was collected through questionnaires given to 90 mothers of toddlers aged 24-59 months in Wage Village who had a Healthy Way Card (KMS) or Maternal and Child Health Book (KIA); the sample size was calculated using the Compare Two Proportions formula, sampling techniques using Purposive Consecutive Sampling, and Fisher's Exact test was used to see the correlation between the two variables. Results: The results of this study show that there is no significant correlation between the knowledge of mothers of toddlers about immunization and compliance with providing complete routine immunization (p=0.434), and there is no significant correlation between the attitude of mothers of toddlers about immunization and compliance with providing complete routine immunization (p=1.000). Conclusion: The results of this study indicate that neither the knowledge nor attitudes of mothers of toddlers regarding immunization have a significant correlation with compliance in providing complete routine immunization in Wage Village, Taman District, Sidoarjo Regency. Efforts to increase immunization compliance need to focus on other aspects, such as cross-sectoral cooperation, accessibility of health services and more comprehensive education programs for mothers of toddlers, families and the community.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141795898","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Severe SARS COV2 pneumonitis and stroke about two cases","authors":"Jamal Oujaber, Soufiane Sassi, Rachid Benchanna, Hicham Janah, Rachid Bouchentouf, Amine Benjelloun","doi":"10.30574/wjarr.2024.23.1.2066","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2066","url":null,"abstract":"In late December 2019, coronavirus disease was first reported in WUHAN, China. Clinical presentation varies from asymptomatic infection to severe pneumonia often associated with cardiovascular, thromboembolic and neurovascular complications most notably stroke. Ischemic stroke is a diagnostic and therapeutic emergency both outside and during the covid19 crisis, we report two clinical cases of patients who presented with an episode of stroke during their hospital stay in the units dedicated to covid19.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141795946","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Arundhati Kashyap, Deeparani Urolagin, Ansari Aashif Raza Mohd Imtiyaz, Samir Panda, Deepika H L
{"title":"The role of pharmacological interventions in managing hyperlipidemia: A closer look at different drugs","authors":"Arundhati Kashyap, Deeparani Urolagin, Ansari Aashif Raza Mohd Imtiyaz, Samir Panda, Deepika H L","doi":"10.30574/wjarr.2024.23.1.1598","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.1598","url":null,"abstract":"Hyperlipidemia is a medical condition characterized by an increase in plasma lipids, including triglycerides, cholesterol, cholesterol esters, phospholipids, and plasma lipoproteins, which is a leading risk factor for cardiovascular diseases. The pathophysiology of hyperlipidemia is influenced by endothelial damage to blood vessels, leading to a loss of nitric oxide, increased inflammation, and lipid accumulation in the deepest layer of the endothelial wall. Lipid-lowering drugs like statins can reduce LDL levels by 25-60%, but they have negative impacts on clinical outcomes. Lipoprotein metabolism involves various enzymes, and atherosclerosis accumulates fat, cholesterol, and calcium in artery linings, creating fibrous plaques that reduce blood flow and oxygen supply, leading to heart damage and death. Lipoprotein metabolism involves various enzymes, including lipoprotein lipase (LPL), hepatic lipase (HL), lecithin cholesterol acyl transferase (LCAT), cholesterol ester transfer protein (CETP), microsomal triglyceride protein (MTP), and acyl Co-A transferase (ACAT). Atherosclerosis accumulates fat, cholesterol, and calcium in artery linings, creating fibrous plaques. This leads to reduced blood flow and oxygen supply, causing heart damage and death. Reducing LDL and total cholesterol can significantly lower the incidence of strokes. Reducing LDL and total cholesterol can significantly lower the incidence of strokes. Traditional antihyperlipidemic medicines have negative effects, and herbal treatments like onion, garlic, guggul, and Asparagus racemosus have been shown to have anti-diabetic and antihyperlipidemic properties.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141795967","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Emmanuel Sunday Oni, Ojo Moses Oke, Josephine Kpalap, Samuel Kehinde Wojuade, Adewale Oke, Emmanuel Ayomide Oni
{"title":"Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria","authors":"Emmanuel Sunday Oni, Ojo Moses Oke, Josephine Kpalap, Samuel Kehinde Wojuade, Adewale Oke, Emmanuel Ayomide Oni","doi":"10.30574/wjarr.2024.23.1.2164","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2164","url":null,"abstract":"There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141795970","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Abideen David Amodu, Chukwuemeka Oluebube Ochuba, Ibrahim Temitope Badirudeen, Kingsley Okwuruoha Ikeokwu
{"title":"Vaccine inequalities, hesitancy, and media-focused public health interventions in English-speaking West-African Countries","authors":"Abideen David Amodu, Chukwuemeka Oluebube Ochuba, Ibrahim Temitope Badirudeen, Kingsley Okwuruoha Ikeokwu","doi":"10.30574/wjarr.2024.23.1.1944","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.1944","url":null,"abstract":"Background: Vaccine hesitancy poses a significant challenge to public health efforts in English-speaking West-African countries amidst the COVID-19 pandemic. This study aims to examine the multifaceted factors contributing to vaccine hesitancy in the region, including issues of trust, misinformation, cultural beliefs, and access barriers. Methods: This study reviewed data from three African countries, Nigeria, Ghana, and the Gambia, to analyze attitudes towards vaccination. It also assessed variations in attitudes across these countries and compared them with attitudes in the western world. Qualitative and quantitative methods were employed to gather and analyze data on vaccine hesitancy and related factors. Results: The study found substantial variation in attitudes towards vaccination across the surveyed countries and compared to the western world. Factors contributing to vaccine hesitancy included historical injustices, misinformation, cultural beliefs, and access barriers such as limited healthcare infrastructure and vaccine supply constraints. Media-focused public health interventions were identified as crucial in addressing vaccine inequalities and enhancing vaccine acceptance. Conclusion: Overcoming vaccine hesitancy in West Africa requires tailored approaches that acknowledge and address historical injustices and inequities, emphasize culturally appropriate messaging, and utilize existing community infrastructure to deliver accurate information. Targeted communication strategies are essential to combat misinformation and enhance vaccine acceptance. By analyzing the intersection of vaccine hesitancy, media interventions, and public health challenges, this study underscores the need for comprehensive and community-engaged campaigns to promote vaccination and combat the spread of COVID-19 in West Africa.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141795973","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
M. E. Khan Chowdhury, Md. Enamul Haque, Mehrun Nesa, Biswanath Sikdar, Md. Faruk Hasan
{"title":"Identification and biological control of bacterial leaf spot disease of cucurbits","authors":"M. E. Khan Chowdhury, Md. Enamul Haque, Mehrun Nesa, Biswanath Sikdar, Md. Faruk Hasan","doi":"10.30574/wjarr.2024.23.1.2139","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2139","url":null,"abstract":"Objective: The present study was conducted for isolation and detection of the phyto-pathogen responsible for bacterial leaf spot disease of cucurbits as well as evaluation of its biological control techniques. Methods: The pathogen of the disease was isolated from infected leaf of bitter gourd and cultured on Luria-Bertani (LB) growth medium. The morphological tests and biochemical tests revealed the isolated bacteria as gram negative. Furthermore, advanced molecular technique was applied to facilitate proper detection of the isolated bacteria. The PCR of the bacterial genomic DNA using specific primers generated clear band of approximately 1450 bp in gel electrophoresis. Results: In gram staining test, the bacterial strain was found to be rod shaped and pinkish in color and Gram-negative. All the biochemical test showed positive without mannitol salt agar. The nucleotide sequencing of 16S rDNA gene of the bacterial isolate showed 86.02% similarities with the original sequence of Xanthomonas cucurbitae. In antibiotic sensitivity assay, the antibiotic cefixime showed highest 28.0±0.7 mm diameter of inhibition zone against the tested bacteria. The highest antibacterial activity was 8.0±0.5 mm zone of inhibition by of Allium sativum. Conclusion: The present findings may be benevolent for the detection, characterization and development of biological control techniques to prevent the leaf spot disease of cucurbits crops in Bangladesh. It may help to find out the specific signaling pathway techniques for plant microbes relationship for disease formation in future.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141795982","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Lipid droplets in cancer: A review of their implications for tumor biology and treatment","authors":"Kelly Osayi Otakhor, Elizabeth O. Soladoye","doi":"10.30574/wjarr.2024.23.1.2037","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2037","url":null,"abstract":"Lipid droplets (LDs) are intracellular organelles traditionally known for their role in lipid storage and energy homeostasis. Recent research has unveiled their significant involvement in cancer biology, revealing them as dynamic structures that contribute to various aspects of tumor development and progression. This review delves into the multifaceted roles of LDs in cancer, highlighting their implications for tumor biology and potential therapeutic strategies. LDs are increasingly recognised for their ability to modulate cellular metabolism, signaling pathways, and stress responses in cancer cells. Their accumulation is often observed in various tumor types, correlating with aggressive phenotypes and poor prognosis. LDs support rapid cell proliferation by providing essential lipids for membrane synthesis and energy production, enabling cancer cells to thrive under metabolic stress. Furthermore, LDs serve as hubs for lipid signaling molecules, influencing key oncogenic pathways such as the PI3K/Akt/mTOR and Wnt/β-catenin pathways, thereby promoting tumorigenesis and metastasis. Beyond their metabolic functions, LDs contribute to the oxidative stress response and lipid peroxidation, mechanisms that can either facilitate cancer cell survival or lead to cell death, depending on the context. The dual role of LDs in regulating reactive oxygen species (ROS) levels underscores their complexity in cancer biology. Importantly, LDs have emerged as potential targets for cancer therapy. Strategies to disrupt LD formation, enhance lipid catabolism, or modulate lipid signaling are being explored to impair tumor growth and sensitize cancer cells to treatment. Pharmacological agents targeting LD-associated proteins, such as perilipins and diacylglycerol acyltransferase (DGAT) inhibitors, are showing promise in preclinical models. LDs play a critical and versatile role in cancer biology, influencing tumor metabolism, signaling, and stress responses. Understanding the intricate functions of LDs in cancer can pave the way for novel therapeutic approaches, offering hope for more effective treatments in oncology. This review underscores the need for further research to fully elucidate the therapeutic potential of targeting LDs in cancer.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141796039","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Ni Gusti Ayu Ekayanti, I Gusti Ayu Made Asri Dwija Putri
{"title":"Moderates of job relevant information: Budget participation, information asymmetry, autonomous budget motivation and budgetary slack","authors":"Ni Gusti Ayu Ekayanti, I Gusti Ayu Made Asri Dwija Putri","doi":"10.30574/wjarr.2024.23.1.2073","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2073","url":null,"abstract":"The purpose of this research is to determine the effect of budget participation, information asymmetry, and autonomous budget motivation on budgetary slack directly or moderated by job relevant information. The population in this research is all village officials in Gianyar Regency who are involved in preparing the village budget in Gianyar Regency. Sampling in this research was carried out by purposive sampling with a sample size of 192 people. Research data was collected through the results of distributing questionnaires and analyzed using the Partial Least Square/PLS analysis technique. The research results state that budget participation has a positive effect on budgetary slack. Information asymmetry has no effect on budgetary slack. Autonomous budget motivation has a negative effect on budgetary slack. Job relevant information is unable to moderate the influence of budget participation on budgetary slack. Job relevant information is unable to moderate the influence of information asymmetry on budgetary slack. autonomous budget motivation against budgetary slack.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141796060","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Youth empowerment for national development in Cameroon: The case of youths in Buea municipality, south West Region","authors":"Foncha Samuel Ngouafo Tafuh, Budi Puspo Priyadi","doi":"10.30574/wjarr.2024.23.1.2233","DOIUrl":"https://doi.org/10.30574/wjarr.2024.23.1.2233","url":null,"abstract":"Youth empowerment remains a major issue in Cameroon and the world at large. This study sought to establish the link between youth empowerment and National Development, examine the activities of the government in the process of empowering youth as well as asses the challenges faced in empowering youths in Buea municipality, South West Region of Cameroon. A cross-sectional descriptive design was used. Random sampling procedure was used to select the youths. The sample size comprised 60 respondents. A 5-point Likert scale was, where variables were categorized as follows: strongly agree, agree, neutral, disagree, and strongly disagree. Data were presented as means of each group of charts and graphs. The results revealed that there were strategies used by the government to empower youths in the municipality with policies that emerged from the study such as the Cameroon national youth policy (2006), Special youth triennial plan, Growth and Empowerment Strategy Paper (GESP 2010) even thou they were not that adequate enough. Conclusion given was that such as financial literacy training should be open for all youths, public partnerships should be fostered between the government, development partners, non-governmental organizations, financial institutions and other relevant financial institutions to help youths to access information and capital were then given to ensure and promote adequate youth empowerment.","PeriodicalId":23739,"journal":{"name":"World Journal of Advanced Research and Reviews","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2024-07-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"141796145","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}