JURNAL PESISIR DAN LAUT TROPIS最新文献

{"title":"KEKAYAAN DAN POTENSI SENYAWA BIOAKTIF MAKROALGA DI PESISIR ATEP OKI, KABUPATEN MINAHASA, SULAWESI UTARA","authors":"Silsia Dorkas Winowoda, M. Singkoh, Ratna Siahaan","doi":"10.35800/jplt.8.3.2020.30454","DOIUrl":"https://doi.org/10.35800/jplt.8.3.2020.30454","url":null,"abstract":"This study aims to analyze the richness and potential of macroalgae bioactive compounds on the Atep Oki Coast, District of Minahasa, North Sulawesi Province. This research was conducted in October 2019 until January 2020. Sampling used the roaming method in a predetermined location that is Atep Oki tidal/ intertidal coast. Sampling locations are spread over six coordinate points. Macroalgae found on the Atep Oki Coast assessed ten species belonging to three phyla, namely Chlorophyta (green algae), Ochrophyta (brown algae) and Rhodophyta (red algae). Chlorophyta members mean six species. Ochrophyta has members of three species and members of Rhodophyta only one species. The types of macroalgae found on the Atep Oki Coast provide bioactive compounds. Keywords : Macroalgae, Bioactive Compounds, Atep Oki Minahasa CoastAbstrak Penelitian ini bertujuan untuk menganalisis kekayaan jenis dan potensi senyawa bioaktif makroalga di Pesisir Atep Oki, Kabupaten Minahasa, Provinsi Sulawesi Utara. Penelitian ini telah dilaksanakan pada bulan Oktober 2019 sampai Januari 2020. Pengambilan sampel menggunakan metode jelajah di lokasi yang telah ditentukan yaitu pesisir pasang surut/intertidal Atep Oki. Lokasi pengambilan sampel tersebar di enam titik-titik koordinat. Makroalga yang ditemukan di Pesisir Atep Oki berjumlah sepuluh species yang tergolong ke dalam tiga filum yaitu Chlorophyta (alga hijau), Ochrophyta (alga cokelat) dan Rhodophyta (alga merah). Anggota Chlorophyta berjumlah enam species. Ochrophyta memiliki anggota tiga species dan anggota Rhodophyta hanya satu species. Jenis-jenis makroalga yang ditemukan di Pesisir Atep Oki berpotensi menghasilkan senyawa bioaktif. Kata kunci : Makroalga, Senyawa Bioaktif, Pesisir Atep Oki Minahasa","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-09-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84411701","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"PENGARUH LOGAM BERAT TIMBAL TERHADAP PERTUMBUHAN ALGA Halimeda opuntia YANG DIKULTUR DALAM WADAH TERKONTROL","authors":"Kristian Sugiarto, D. Mantiri, Nickson J Kawung, R. Rompas, S. Tilaar, A. Wantasen","doi":"10.35800/jplt.8.3.2020.32239","DOIUrl":"https://doi.org/10.35800/jplt.8.3.2020.32239","url":null,"abstract":"Heavy metal is a very dangerous pollutant waste for it cannot be destroyed (non-degradable) and over time it will accumulate in the ocean. This study aims to determine the lead content in sediment, water and algal thallus as well as to determine the algae growth that has been treated with lead. The research method used was a completely randomized design (CRD) which consisted of 3 treatments, using different treatments for each sample. The highest metal content obtained in the sediment was 5,124 ppm, in the water was 0.120 ppm, and in the algae thallus was 4,816 ppm respectively. The results showed that Halimeda opuntia algae can grow even in an environment contaminated with lead heavy metal and can become a bioremediation agent by absorbing lead heavy metal. Keywords: Halimeda opuntia, Lead Heavy Metal, Algae Culture, Bioremediation             Logam berat merupakan salah satu limbah pencemar yang sangat berbahaya karena tidak dapat dihancurkan (non degradable) dan dapat terakumulasi di perairan laut. Penelitian ini bertujuan untuk mengetahui kandungan timbal pada sedimen, air dan thallus alga yang dikultur serta mengetahui pertumbuhan alga yang telah diberi perlakuan timbal. Metode penelitian mengunakan metode Rancangan Acak Lengkap (RAL) yang terdiri dari 3 perlakuan, dengan menggunakan perlakuan yang berbeda pada tiap sampel dan kontrol. Kandungan logam tertinggi yang didapatkan pada sedimen yaitu sebesar 5,124 ppm, pada air sebesar 0,120 ppm, dan pada thallus alga sebesar 4,816 ppm. Hasil yang diperoleh yaitu alga Halimeda opuntia dapat bertumbuh walaupun dalam lingkungan yang tercemar logam berat timbal serta mampu menjadi agen bioremediasi dengan menyerap logam berat timbal. Kata kunci: Halimeda opuntia, Logam BeratTimbal, Kultur Alga, Bioremediasi","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-09-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81020595","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"PEMETAAN BATIMETRI PANTAI MALALAYANG DUA, KOTA MANADO","authors":"Abdulrahman Lahay, Rignolda Djamaluddin, Hermanto W. K. Manengkey, Brama Djabar","doi":"10.35800/jplt.8.3.2020.30445","DOIUrl":"https://doi.org/10.35800/jplt.8.3.2020.30445","url":null,"abstract":"As with other coastal areas, Malalayang Dua Coast has been used for various activities and is predicted to continue to grow along with the development of Manado City. To support efforts to manage and utilize coastal space in an effective and sustainable manner, data and information are needed related to oceanographic factors, one of which is the bathymetry condition of the coastal waters. This research was carried out with the aim of describing the bathymetric conditions and analyzing the slope of the bottom of the waters. The depth measurement by acoustic method was carried out along 15 survey lines and 750 fixed measurement points, and the bathymetry map was drawn with reference to Mean Seawater Level (MSL). The results obtained indicate that the bathymetry of Malalayang Dua Coast in the west has shallow waters that are wider than the eastern one. Meanwhile, parts of the waters deeper up to a depth of 50 m appear to be steeper in the West than on the East side. In the middle part of the observed waters, there is a part that is relatively deep and protrudes towards the land with a steeper side towards the east. The slope of the bottom of the water in the west (Profile 1) is indicated by flat slopes (2.6%) to a depth of 7 m, and slopes (13%) at a depth of 7 m to 50 m. In the middle section (Profile 2) the slope is categorized as gentle (3%) to a depth of 4 m, and inclined slopes (10%) at a depth of 4 m to 50 m. In the eastern part (Profile 3) the slopes are categorized as sloping slopes (10.28) to a depth of 35 m, and gentle slopes (3.42%) at a depth of 35 m to 50 m. Keywords: bathymetry, acoustics, slope, Malalayang Dua CoastAbstrakSebagaimana wilayah pantai pada umumnya, Pantai Malalayang Dua telah dimanfaatkan untuk berbagai aktivitas dan diprediksi akan terus berkembang seiring perkembangan Kota Manado. Untuk menunjang upaya pengelolaan dan pemanfaatan ruang pantai secara efektif dan berkelanjutan, diperlukan data dan informasi terkait faktor oseanografi dimana salah satu yang penting yaitu kondisi batimetri perairan pantai tersebut. Penelitian ini dilaksanakan dengan tujuan untuk menggambarkan kondisi batimetri dan menganalisis kemiringan lereng dasar perairan. Pengukuran kedalaman dengan metode akustik dilakukan sepanjang 15 lajur perum dan 750 titik fix perum, dan peta batimetri digambarkan dengan referensi Muka Laut Rata-rata (Mean Seawater Level - MSL). Hasil yang diperoleh menunjukkan bahwa batimetri Pantai Malalayang Dua sebelah Barat memiliki perairan dangkal yang lebih lebar dibandingkan sebelah Timur. Sementara itu, untuk bagian perairan yang lebih dalam hingga kedalaman 50 m nampak lebih terjal di bagian Barat dibandingkan sisi sebelah Timur. Pada bagian tengah perairan yang diamati, terdapat bagian yang relatif dalam dan menjorok ke arah darat dengan sisi yang lebih terjal ke arah sebelah Timur. Kemiringan lereng dasar perairan di sebelah Barat (Profil 1) terindikasi lereng datar (2,6%) hingga kedalaman 7 m, dan lereng miring (13%","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-09-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"83712240","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"KARAKTERISASI DAN PENAPISAN AKTIVITAS ANTIBAKERI ISOLAT BAKTERI SIMBION Thurudilla lineolata DAN Phyllidiella pustulosa","authors":"Kevien Marthin Doringin, Rosita A J Lintang, Deiske A. Sumilat","doi":"10.35800/jplt.8.3.2020.32242","DOIUrl":"https://doi.org/10.35800/jplt.8.3.2020.32242","url":null,"abstract":"Nudibranch are part of a class og Gastropods that do not have a shell and has a bright and striking colour. Nudibranch has different of bacteria and bioactive compounds contained therein for protect theselves from predators.The aim of this study were to isolate symbiotic bacterial drived from Thurudilla lineolata and Phyllidiella pustulosa, and to observe the antibacterial activity of bacterial isolate against Escherichia coli and Staphylococcus aureus. Isolation and culture of the symbiotic bacterial were made on Nutrient Agar. The antibacterial screening showed that Thrudilla lineolata and Phyllidiella pustulosasymbiotic bacteria were able to inhibit the growth of against Escherichia coli and Staphylococcus aureus Nudibranch merupakan bagian dari kelas Gastropoda yang tidak memiliki cangkang dan memiliki warna cerah dan mencolok. Nudibranch memiliki berbagai jenis bakteri dan senyawa bioaktif yang terkandung di dalamnya untuk melidungi diri dari predator. Tujuan dari penelitian ini yaitu untuk mendapatkan isolat bakteri yang bersimbion dengan Thrudilla lineolata dan Phyllidiella pustulosa, kemudian mengamati aktivitas antibakteri dari isolat bakteri tersebut terhadap Escherichia coli, dan Staphylococcus aureus. Isolasi dan kultur bakteri yang bersimbion dengan Thrudilla lineolata dan Phyllidiella pustulosa, dibuat pada media Nutrient Agar. Skrining aktivitas antibakteri menunjukkan isolat bakteri yang bersimbion dengan Thrudilla lineolata dan Phyllidiella pustulosa mampu menghambat pertumbuhan organisme uji Staphylococcus aureus dan Escherichia coli. Kata kunci: Nudibranch, Thrudilla lineolata, Phyllidiella pustulosa, bakteri, isolasi, antibakter","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-09-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78133733","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"UJI AKTIVITAS ANTIBAKTERI DAN ANTI-UV Phyllidiella nigra DAN BAKTERI SIMBIOTIKNYA DARI PERAIRAN TANJUNG MANDOLANG","authors":"Tessalonica Dajoh, R. Bara, E. Angkouw, Medy Ompi, Rosita A J Lintang, Cykca Lumenta","doi":"10.35800/jplt.8.2.2020.29768","DOIUrl":"https://doi.org/10.35800/jplt.8.2.2020.29768","url":null,"abstract":"Phyllidiella nigra is an organism that is suspected to have secondary metabolites because their ability to develop its self defense system by camouflage and using chemical compounds derived from their nature diet as deterrent against their predators. The purpose of this study was to isolate symbiotic bacterial derived from P. nigra, extracted and followed by, the antibacterial assays against Escherichia coli and Bacillus megaterium as well as the anti-UV assay. The results showed that the five isolates tested had an antibacterial activity with the highest average inhibition zone against E. coli DSM 498 bacteria, isolate 1 (14.67 mm), isolate 5 (14 mm), and against B. Megaterium DSM 32T bacteria, isolate 3 (13.33 mm). The three isolates which had the highest inhibition zone and P. nigra extract were tested for anti-UV assay using a UV-Vis Spectrophotometer. The results obtained isolate 3 has absorption of UV-A with the UV absorbtion maximum at λ 340 nm and P. nigra extract has absorption on UV-B radiation with UV absorption maximum at λ 290 nm. Key words: Nudibranchia, Bacteria, Anti-bacteial, Anti-UV Phyllidiella nigra merupakan organisme yang diduga memiliki metabolit sekunder karena mampu mengembangkan sistem pertahanan dirinya dengan cara kamuflase dan menggunakan senyawa kimia sebagai racun yang didapat dari makanannya. Tujuan dari penelitian ini yaitu mendapatkan isolat bakteri yang bersimbiosis dengan P. nigra, mendapatkan ekstrak dari baktri simbion, dan menguji antibakteri dan anti-UV ekstrak etil aseta bakteri simbion dengan metode difusi agar terhadap bakteri Escherichia coli dan Bacillus megaterium. Hasil penelitian didapatkan kelima isolat yang diuji memiliki aktivitas antibakteri dengan rerata zona hambat tertinggi terhadap bakteri E. coli DSM 498 yaitu isolat 1 (14,67 mm), isolat 5 (14 mm), dan terhadap baktri B. megaterium DSM 32T yaitu isolat 3 (13,33 mm). Ketiga isolat yang memiliki zona hambat tertinggi dan ekstrak P. nigra diujikan anti-UV menggunakan alat UV-Vis Spektrofotometer. Hasil yang didapat isolat 3 memiliki serapan terhadap radiasi sinar UV-A dengan puncak tertinggi pada λ 340 nm dan ekstrak P. nigra memiliki serapan terhadap radiasi sinar UV-B dengan puncak tertinggi berada pada λ 290 nm. Kata kunci: Nudibranchia, Bacteria, Anti-bacteial, Anti-UV","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81992590","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"STRUKTUR KOMUNITAS MANGROVE DI DESA LESAH, KECAMATAN TAGULANDANG, KABUPATEN SITARO","authors":"Indra Asman, C. Sondak, Joshian N. W. Schaduw, D. Kumampung, Medy Ompi, Haryani Sambali","doi":"10.35800/jplt.8.2.2020.28769","DOIUrl":"https://doi.org/10.35800/jplt.8.2.2020.28769","url":null,"abstract":"Mangroves are forests that grow in brackish water and are affected by tides and seawater, and these forests grow specifically in places where there are pavement and accumulation of organic material. The purpose of this research is to identify the types of mangroves and determine the structure of the mangrove community in Lesah Village. This research was conducted from September to October 2019. The method used in this research is the quadrant line transect method. The types of mangroves were identified with identification books. Community structure data taken are density, frequency, dominance and important value index (IVI) and then analyzed with Microsoft Excel program. Based on the results of the research, there are 2 types of mangroves found in the research location, Rhizophora stylosa and Sonneratia alba. The highest density value (0.122 ind / m2), relative density (81.88%), frequency types (1), relative frequency (50%). Closure types (1.83 m2), types of relative closure (50.18%), the highest important value index at the research site was (182.12%). The results of the mangrove ecological index data analysis for the diversity index value (0.51), dominance (0.73). Keywords: Structure Community, Mangrove, Lesah Village. Abstrak Mangrove adalah hutan yang tumbuh di air payau, dan dipengaruhi oleh pasang surut air laut dan hutan ini tumbuh khususnya di tempat-tempat di mana terjadi pelumpuaran dan akumulasi bahan oraganik. Tujuan dari penelitian adalah mengidentifikasi jenis-jenis mangrove dan mengetahui struktur komunitas mangrove di Desa Lesah. Penelitian dilaksanakan dari September-Oktober 2019. Metode yang digunakan adalah metode line transek kuadran. Jenis-jenis mangrove di identifikasi dengan bantuan buku identifikasi. Data struktur komunitas yang di ambil adalah kerepatan, ferkuensi, dominasi dan indeks nilai penting(INP) dan kemudian di analisa dengan bantuan program computer Microsoft Excel. Berdasarkan hasil penelitian terdapat 2 jenis mangrove yang terdiri dari, Rhizophora stylosa dan Sonneratia alba. Nilai kerepatan tertinggi (0.122 ind/m2), kerapatan relatif jenis (81.88%), frekuensi jenis (1), frekuensi relatif jenis (50%). Penutupan jenis (1.83 m2), penutupan relatif jenis (50.18%), indeks nilai penting tertinggi dilokasi penelitian adalah (182.12%). Hasil analisis data indeks ekologi mangrove untuk nilai indeks keanekaragaman (0.51), dominasi(0.73). Kata Kunci: Struktur Komunitas, Mangrove, Desa Lesah.","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75449658","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"ISOLASI BAKTERI YANG BERSIMBION DENGAN ASCIDIAN Herdmania momus YANG MEMILIKI AKTIVITAS ANTIBAKTERI","authors":"Silvia E Koyongian, Deiske A. Sumilat, Rosita A J Lintang, Stenly Wullur, Sandra Tilaar, Henneke Pangkey","doi":"10.35800/jplt.8.2.2020.28766","DOIUrl":"https://doi.org/10.35800/jplt.8.2.2020.28766","url":null,"abstract":" Ascidian is marine invertebrates in coral reef ecosystems that produce many bioactive compounds for pharmacology. The presence of symbiotic bacteria with marine organisms is protected the host biota by producing secondary metabolites. The purpose of this study is to obtain symbiotic bacterial isolates with Herdmania momus ascidian, then to observe the antibacterial activity of these bacterial isolates against Escherichia coli, and Staphylococcus aureus. Isolation and culture of the symbiotic bacteria were made on Nutrient Agar and Zobell Marine Broth media. The antibacterial screening showed that the Herdmania momus symbiotic bacteria were able to inhibit the growth of Staphylococcus aureus and Escherichia coli.Keywords: ascidians, Herdmania momus, bacteria, isolation, antibacterialAbstak          Ascidian adalah avetebrata laut di ekosistem terumbu karang yang banyak menghasilkan senyawa bioaktif untuk bidang farmakologi. Keberadaan bakteri yang bersimbion dengan organisme laut pada umumnya untuk melindungi biota yang ditumpanginya dan dirinya dengan cara menghasilkan senyawa metabolit sekunder. Tujuan dari penelitian ini yaitu untuk mendapatkan isolat bakteri yang bersimbion dengan ascidian Herdmania momus, kemudian mengamati aktivitas antibakteri dari isolat bakteri tersebut terhadap Escherichia coli, dan Staphylococcus aureus. Isolasi dan kultur bakteri yang bersimbion dengan ascidian dibuat pada media Nutrient Agar dan Zobell Marine Broth. Skrining aktivitas antibakteri menunjukkan isolat bakteri yang bersimbion dengan ascidian Herdmania momus mampu menghambat pertumbuhan organisme uji Staphylococcus aureus dan Escherichia coli.Kata kunci: ascidian, Herdmania momus, bakteri, isolasi, antibakteri","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84211498","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Efek Senyawa Timbal Asetat Terhadap Pertumbuhan Dan Kandungan Pigmen Klorofil Mikroalga Dunaliella sp.","authors":"Joshep Tamalonggehe, Kurniati Kemer, D. S. Paransa, D. Mantiri, Nickson J Kawung, Suzanne L Undap","doi":"10.35800/jplt.8.2.2020.28764","DOIUrl":"https://doi.org/10.35800/jplt.8.2.2020.28764","url":null,"abstract":"Microalgae is one of the marine biota that has an important role in the waters because it acts as a supplier of food in the waters. Microalgae is a biological source that needs to be exploited because it is rich in essential compounds. Dunaliella sp. is one of the many micro algae used as research. Utilization of Dunaliella sp. quite diverse and has been marketed in developed countries because of its very attractive economic value. This study aims to determine the effects of lead acetate compounds on growth and content of chlorophyll pigments microalgae Dunaliella sp. The results obtained in this study are the lead acetate compounds can affect the number of cells in the growth of microalgae and analysis results obtained with a spectrophotometer showed that the extraction concentration of control day 5 (Exponential Phase) was higher than the concentration of 15 ppm and 25 ppm, whereas extraction on day 21 (Death Phase) concentration of 15 ppm was higher than 25 ppm.Keywords : Dunalella sp., Lead Acetate, Pigment chlorophyll RingkasanMikroalga adalah salah satu biota laut yang memiliki peran penting di perairan karena berfungsi sebagai pemasok makanan di perairan. Mikroalga adalah sumber biologis yang perlu dieksploitasi karena kaya akan senyawa esensial. Dunaliella sp. adalah salah satu dari banyak mikroalga yang digunakan sebagai penelitian. Pemanfaatan Dunaliella sp. cukup beragam dan telah dipasarkan di negara maju karena nilai ekonominya yang sangat menarik. Penelitian ini bertujuan untuk mengetahui efek senyawa timbal asetat terhadap pertumbuhan dan kandungan pigmen klorofil Dunaliella sp. Hasil yang diperoleh dalam penelitian ini adalah senyawa timbal asetat dapat mempengaruhi jumlah sel dalam pertumbuhan mikroalga, penurunan jumlah sel mengikuti konsentrasi timbal asetat yang diberikan dan hasil analisis yang diperoleh dengan spektrofotometer menunjukkan bahwa konsentrasi ekstraksi kontrol hari 5 (Fase Eksponensial) lebih tinggi daripada konsentrasi 15 ppm dan 25 ppm, sedangkan ekstraksi hari 21 (Fase Kematian) konsentrasi 15 ppm lebih tinggi dari 25 ppm.Kata kunci : Dunaliella sp., Timbal Asetat, Pigmen Klorofil","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"86582426","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER","authors":"Oktavianus Dalenoh, Stenly Wullur, Elvy Ginting, Veibe Warouw, Detty N Rumampuk, Henneke Pangkey","doi":"10.35800/jplt.8.2.2020.29909","DOIUrl":"https://doi.org/10.35800/jplt.8.2.2020.29909","url":null,"abstract":"The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny of the isolate was constructed using Neighbor Joining Tree method. Isolate bacteria F0-0-3-1 from culture of rotifer fed with fish waste diet was successfully propagated for molecular analysis. 16S rRNA gene of the isolate bacteria was successfully amplified and showed a DNA band at 1400 bp. Nucleotides sequence quality of the 16S rRNA gene i.,e QV+20 and CRL were 995 and 941 nucletides. BLAST result of the 16S rRNA gene showed 98.87% percent identity of the isolate bacteria F0- 0-3-1 with bacterial species in the genus Bacillus i.e. Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Molecular phylogeny analysis showed that the three species was in the same clade.Keywords: Phylogeny, molecular, bacteria, rotifer, 16S rRNA gene Penelitian ini bertujuan untuk mengkonstruksi filogeni molekuler bakteri yang diduga terlibat dalam proses penguraian limbah perikanan sebagai pakan untuk kultur rotifer. Isolat bakteri yang diperoleh dari kultur rotifer tersebut, dibiakkan dan DNA genomnya diekstrak menggunakan DNeasy Blood and Tissue Kit (Qiagen). Gen 16S rRNA isolat bakteri tersebut, diamplifikasi menggunakan primer 8F (AGAGTTTGATCCTGGCTCAG) dan 1492R (GGTTACCCT GTTACGACTT) selanjutnya, disekuens dan urutan nukleotida hasil sekuens dianalisis menggunakan program Sequence Scanner dan MEGA 7. Analisis homologi sekuens dilakukan dengan program BLAST nucleotide blast, pada situs NCBI (www.ncbi.nml.nih.gov) dan dilanjutkan dengan konstruksi filogeni molekuler menggunakan metode Neigbor Joining Tree. Isolat bakteri F0-0-3-1 berhasil disolasi dari kultur rotifer yang diberi pakan limbah ikan. Hasil amplifikasi Gen 16S rRNA isolat bakteri F0-0-3-1 terdeteksi dalam bentuk pita DNA pada posisi sekitar 1400 bp. Kualitas nukleotida gen 16S rRNA hasil sekuens menunjukan nilai QV 995 dan CRL 941. Hasil BLAST sekuens gen 16S rRNA isolat bakteri F0-0-3-1 pada database menunjukkan kemiripan 98% dengan spesies Bacillus wiedmanni. Hasil kontruksi filogeni menggunakan metode Neighbor Joining Tree menunjukan posisi isolat bakteri F0-0-3-1 berada pada clade yang sama dengan Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Kata kunci: Filogeni, molekuler, bakteri, rotifer, Gen 16S rRNA","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"73799018","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"ANALISIS STRUKTUR KOMUNITAS MANGROVE DI KAWASAN SEKITAR PT. CONCH KABUPATEN BOLAANG MONGONDOW","authors":"George L Pandeirot, Anton P Rumengan, Carolus P. Paruntu, Surya Darwisito, Medy Ompi, A. Wantasen","doi":"10.35800/jplt.8.2.2020.30000","DOIUrl":"https://doi.org/10.35800/jplt.8.2.2020.30000","url":null,"abstract":"This research was conducted for four months of April-July 2020. The purpose of this study was to determine species density, species relative density, species frequency, species relative frequency, species cover, species relative cover, index of the importance of mangrove species in the area around PT. Conch Lolak District, Bolaang Mongondow Regency, North Sulawesi Province. This research was conducted for four months of April-July 2020. The method used was a quadratic plot of 6 stations. Data collection at each station was made with a plot size of 10 × 10 m2 to measure the diameter of a tree at breast height (DBH), which has a minimum trunk circumference of 16 cm. The results showed that there were five types of mangroves, namely R. apiculata, R. mucronata, B. gymnorhiza, S. alba, and X. granatum. The highest relative density of species at station 2, namely R. mucronate 62.96%, while the lowest value at station 3, namely R. mucronata 8.77%, the highest relative frequency value at station 4, namely R. mucronata 33.33%, whereas the lowest value was at station 5, namely B. gymnorhiza 25.00%, the highest relative closure value was at station 5, namely R. mucronata 30.91%, while the lowest was at station 2, namely R. apiculata 12.88%, and the important value index the highest was at station 3, namely R. apiculata 138.09% and the lowest value was at station 5, namely X. granatum 35.05%.Kata Kunci: Mangrove, Structure in areas around PT. Conch. Conch, Rhizopora Abstrak Penelitian ini dilakukan selama 4 bulan April-Juli 2020. Tujuan penelitian ini adalah untuk mengetahui kerapatan jenis, kerapatan relatif jenis, frekuensi jenis, frekuensi relatif jenis, penutupan jenis, penutupan relatif jenis, indeks nilai penting jenis mangrove yang ada di kawasan sekitar PT. Conch Kecamatan Lolak, Kabupaten Bolaang Mongondow, Provinsi Sulawawesi Utara. Penelitian ini dilakukan selama 4 bulan April-Juli 2020. Metode yang dipakai adalah plot kuadrat sebanyak 6 stasiun. Pengambilan data pada setiap stasiun dibuat plot dengan ukuran 10 × 10 m2 untuk mengukur diameter pohon setinggi dada (DBH) yang memiliki lingkar batang minimal 16 cm. Hasil penelitian menunjukkan bahwa ada 5 jenis mangrove yaitu R. apiculata, R. mucronata, B. gymnorhiza, S. alba dan X. granatum. Kerapatan relatif jenis tertinggi pada stasiun 2, yaitu R. mucronata 62,96%, sedangkan nilai terendah pada stasiun 3, yaitu R. mucronata 8,77%, nilai Frekuensi relatif jenis tertingi pada stasiun 4, yaitu R. mucronata 33.33%, sedangkan nilai terendah pada stasiun 5, yaitu B. gymnorhiza 25.00%, nilai Penutupan relatif jenis tertinggi pada stasiun 5, yaitu R. mucronata 30,91%, sedangkan terendah pada stasiun 2, yaitu R. apiculata 12,88%, dan Indeks nilai penting tertinggi pada stasiun 3, yaitu R. apiculata 138,09% dan nilai terendah pada stasiun 5, yaitu X. granatum 35,05%.Kata Kunci: Mangrove, kawasan sekitar PT. Conch, Rhizopora  ","PeriodicalId":17792,"journal":{"name":"JURNAL PESISIR DAN LAUT TROPIS","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2020-05-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"76504283","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}