Integrative molecular medicine最新文献

{"title":"Cell-free DNA content in human blastocoel fluid-conditioned media differentiates euploid versus aneuploid embryos","authors":"R. Chosed, Arnav Lal, J. Blalock, T. A. Chang, R. Robinson, Shawn W. Zimmerman, J. Wininger, W. Roudebush","doi":"10.15761/IMM.1000372","DOIUrl":"https://doi.org/10.15761/IMM.1000372","url":null,"abstract":"","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"8 4 Suppl 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"78492896","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Absolute versus relative presentation of tcdB Clostridium difficile biomarker","authors":"I. Brukner, S. Eintracht, Vincenzo Forgetta, A. Spatz, A. Papadakis, M. Oughton","doi":"10.15761/IMM.1000363","DOIUrl":"https://doi.org/10.15761/IMM.1000363","url":null,"abstract":"Clostridium difficile infection is the major etiologic agent of antibiotic-associated pseudomembranous colitis, a disease that can be fatal if unrecognized, or untreated. On average, there are 15000 deaths and 500000 new cases per year, in the USA. Diagnostic biomarkers currently used are the tcdB gene, or its gene product (toxin B). Clinical interpretation of the assay is particularly challenging: (1) biomarker detection is possible without manifestation of symptoms and (2) missing biomarker due to assay sensitivity limitations can be fatal. To resolve clinical uncertainty, quantitative analysis has been considered. Despite multiple efforts, a quantitative tcdB/toxB threshold with a meaningful clinical impact has yet to be established. Herein we shed light as to why mass/volume-based normalisations were fruitless in the past. Specifically, measuring total bacterial flora (using “universal bacterial” 16S qPCR rDNA assay) to calculate relative abundance of C difficile, we demonstrate a strong and significant negative correlation between tcdB biomarker of C difficile (R2=0.73, N=227, P=10-39) and the rest of gut microorganisms. The new parameter (Cq (toxB)-Cq (16SrDNA)) is calculated from two biomarkers, is independent of sampling variability and inherently incorporates the destructive character of C difficile on the rest of micro-flora. By incorporating relative abundance of tcdB (in context of the total bacterial flora), and correcting for “biomass wash-out/dilution effects of acute diarrhea , these biomarkers could collectively enhance the predictive value of CDI testing.","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"32 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"91351656","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Spinal cord injury patients with spasticity and pressure sores: Preliminary report on reconstruction with botulinum toxin treated muscle flaps","authors":"L. Negosanti, Giorgio Sanguinetti, L. Gaiani, M. Battilana, R. Capirossi, S. Landi, R. Sgarzani","doi":"10.15761/imm.1000377","DOIUrl":"https://doi.org/10.15761/imm.1000377","url":null,"abstract":"Background: Pressure sores are frequent complications in spinal cord injured patients (SCI). Unfortunately, spasticity may be associated to SCI, muscle spasms can be very intense in the post-operative period after pressure sore treatment and may cause wound dehiscence. Aim of the study is to investigate the efficacy of botulinum toxin (BTX) in preventing muscle flap spasms and complications in pressure sores treatment. Materials and methods: Prospective, observational, single center study on consecutive adult spinal cord injury patients affected by spasticity and pressure sore, with indication to surgical debridement and reconstruction with muscle flap. Muscle flap was prepared by injection of 100 units of BTX-A 10 days preoperatively. Collected data include patient and wound information, post-operative need for increased dose of anti-spasticity medications compared to the preoperative period, time to complete wound healing, follow up at 6 months. Results: Five adult patients with SCI, spasticity and trochanteric pressure sore were included in the study. All the patients were male, median age was 48. All the patients were paraplegic, and the etiology was spinal cord trauma. All sores were IV degree. Osteomyelitis was confirmed histologically in all the patients. None of the patients needed an increased dose of anti-spasticity medications, compared to the preoperative period. A complete healing of the wound was observed in all the cases 3 weeks after surgery. No recurrences were observed at a six months follow-up. Conclusion: BTX-A can be a useful method to prevent complications in SCI patients and pressures sores, when a muscle flap is planned.","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"39 1 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"90973916","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Targeted lipidomics reveals changes in N-acyl serines by acute exposure to an electric field: Molecular insights into the docking of N-18:1 serine interaction with TRPV1 or PPAR-α","authors":"Y. Nakagawa-Yagi, H. Hara, T. Ohto, H. Nakanishi, Enzo Kawasaki, Takahiro Yamaguchi, A. Hara","doi":"10.15761/imm.1000382","DOIUrl":"https://doi.org/10.15761/imm.1000382","url":null,"abstract":"Alternative therapy with medical devices using high-voltage electric potential (HELP) to generate an electric field (EF) is common in Japan. However, the mechanisms underlying potential health benefits of this therapy remain unclear. Therefore, we investigated the effect of HELP exposure (9 kV /electrode + 9 kV/electrode, 30 min) on N-acyl serines (N-acyl SERs) using selected reaction monitoring (SRM) analysis in plasma samples obtained from healthy human subjects before and after a single treatment session. N-18:1 SER, and N-16:0 SER were significantly upregulated following HELP exposure. Under these conditions, HELP exposure did not exert on levels of N-18:0 SER, N-18:2 SER, N-20:4 SER, and N-22:6 SER. Because N-18:1 ethanolamine (N-18:1 EA) is known to activate, transient receptor potential vanilloid 1 (TRPV1) and peroxisome proliferator-activated receptor-alpha (PPAR-α), we further examined an in silico docking simulation with TRPV1 and PPAR-α. The binding energies with TRPV1 were -6.359 and -6.227 kcal/mol for N-18:1 SER and N-18:1 EA, respectively. The binding energies with PPAR-α were -7.366 and -6.956 kcal/mol for N-18:1 SER and N-18:1 EA, respectively. In human HepG2 cells, N-18:1 SER enhanced fatty acid-binding protein 1 (FABP1) mRNA expression. N-18:1 SER-induced FABP1 mRNA expression was sensitive to the PPAR-α antagonist GW6471. Our findings provide new insights into the molecular mechanisms of the health benefits of EF therapy. Abbreviations: ACOX1: peroxisomal acyl-coenzyme A oxidase 1; DSPS: delayed sleep phase syndrome; EC50: half maximal effective concentration; EF: electric field; FA: fatty acid; FABP1: fatty acid-binding protein 1; HELP: high-voltage electric potential; HODE: hydroxyoctadecadienoic acid; IL: interleukin; MSL: multiple benign symmetric lipomatosis; N-18:2 EA: N-linoleoyl ethanolamine; N-18:1 EA: N-oleoyl ethanolamine; N-16:0 EA: N-palmitoyl ethanolamine; N-18:0 EA: Nstearoyl ethanolamine; NF-κB: nuclear factor-kappa B; NLRP3: nodlike receptor protein 3; N-20:4 SER: N-arachidonyl serine; N-22:6 SER: N-docosahexaenoyl serine; N-18:2 SER: N-linoleoyl serine; N-18:1 SER: N-oleoyl serine; N-16:0 SER: N-palmitoyl serine; N-18:0 SER: N-stearoyl serine; PLAAT: phospholipase A/acyltransferase; PLA2: phospholipase A2; PPAR-α: peroxisome proliferator-activated receptoralpha; qRT-PCR: quantitative real-time polymerase chain reaction; SRM: selected reaction monitoring; TLR4: toll-like receptor 4; TRPV1: transient receptor potential vanilloid 1.","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"5 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"88435586","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Event related potentials (ERPs) and alpha waves in cognition, aging and selected dementias: A source of biomarkers and therapy","authors":"Priya Mirand, Christopher D Cox, Michael Alexander, S. Danev, J. Lakey","doi":"10.15761/imm.1000385","DOIUrl":"https://doi.org/10.15761/imm.1000385","url":null,"abstract":"In 2010, 8% of the world’s population was >65 years of age. The prevalence of dementia in 2015 was 47.47 million, while its incidence was at 7.7 million new cases each year i.e. translates to a new case every 4.1 seconds. Alzheimer’s contributes to 60−70% of cases with dementia. The current global costs of care for dementia is US$ 604 billion/ year. One of the keep obstacles to better treatment outcomes and quality of life is late diagnosis. The present paper covers the role of EEG–based Alpha waves and event-related potential (ERPs) components as biomarkers of cognition and the changes in their features with aging, dementia, and Alzheimer’s. Introduction Normal aging and dementia Epidemiological studies on normal aging and dementia revealed that in 2010 there were 524 million individuals >65 years of age. This accounted for 8% of the world’s population in 2010. The projections for 2050 are that this number is expected to rise to 1.5 billion individuals >65 years and will account for 16% of the world’s projected population [1]. Further alarming statistic is that between 2010 and 2050, the number of older people in less developed countries will increase by 250% as compared with a 71% increase in developed countries [1]. Prevalence of dementia in 2015 was 47.47 million, with 75.63 million and 135.46 million being the projected estimated for 2030 and 2050 respectively [2-6]. Incidence of dementia is 7.7 million new cases each year i.e. translates to a new case every 4.1 seconds. 5%-8% of individuals > 65 age, 15%-20% > 75 age, and 25%-50% of individuals > 85 age have dementia. Alzheimer’s disease (AD) or senile dementia of the Alzheimer’s type (SDAT) contributes to 60−70% of cases with dementia [1-6]. The implications are that not only infrastructure in terms of health care systems and health care givers need to be up-scaled to meet future needs but that globally systems need to be set in place that can ensure we meet the cost of care. Factors influencing costs include; the cost of providing health and social care to the aged and individuals with dementia, effect on the work force in terms both care givers and younger individuals with early dementia and the effect on the family in terms of loss of income/reduction in income for both care givers and younger individuals with early dementia. Current global costs of caring for people with dementia are US$ 604 billion/ year and the projected global estimates is US$ trillion in 2050 [1-6]. Taken together one can appreciate the significant impact of dementia on the global population. *Correspondence to: Jonathan RT Lakey, Department of Surgery, 333 City Blvd West, Suite 1600, Orange, CA 92868, Tel:1-949-824-8022; Fax:1-714-456-6188; E-mail: jlakey@uci.edu Received: October 01, 2019; Accepted: October 17, 2019; Published: October 25, 2019 Electrophysiological studies on cognition While AD accounts for 60−70% of cases with dementia its clear-cut diagnosis from the other types of dementias namely; normal age-","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"124 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87836386","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"About mycoplasma infection","authors":"T. Fuse","doi":"10.15761/IMM.1000355","DOIUrl":"https://doi.org/10.15761/IMM.1000355","url":null,"abstract":"Nasopharyngeal findings are important for the diagnosis and treatment of mycoplasma infection because the diagnosis of this infection is conducted by sputum sampling using Ribotest. By differential diagnosis of nasopharyngeal masses using a fiber rhino laryngoscope, it is possible to ascertain purulent nasal discharge as a characteristic of sinusitis and viscous sputum as a characteristic of mycoplasma. It is important to establish the specific symptoms and nasopharyngeal findings to diagnose a mycoplasma infection.","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"411 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"72984009","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Cardiac TGR5 expression enhanced by hyperglycaemia in diabetic rats: A preclinical warning for disorders with excess bile acids","authors":"F. Kuo, Shu Ping Lee, Juei-Tang Cheng, Ming‐Chang Wu","doi":"10.15761/IMM.1000366","DOIUrl":"https://doi.org/10.15761/IMM.1000366","url":null,"abstract":"Background: Diabetes is a risk factor for cardiovascular disorders. TGR5 levels are increased in cardiomyocytes exposed to hyperglycaemia. The objective of this study was to investigate the potential mechanism(s) for the increase in TGR5 levels in the hearts of diabetic rats. Materials and methods: We used streptozotocin -induced diabetic rats (STZ rats) to assess the role of hyperglycaemia in increased cardiac TGR5 levels. The expression levels of TGR5 and signal transducer and activator of transcription 3, both its phosphorylated form (p-STAT3) and its native form (STAT3), in heart tissues were measured using Western blots. Results: The increased levels of TGR5 and the ratio of p-STAT3 to STAT3 in cardiac tissues exposed to hyperglycaemic conditions were reversed by treating the hyperglycaemia. Additionally, the potential mechanisms of this effect were confirmed in a cultured rat cardiac cell line (H9c2) incubated in high-glucose (HG) medium to mimic the changes observed in vivo. TGR5 expression increased in parallel with the increased ratio of p-STAT3 and STAT3 in H9c2 cells exposed to HG, and these effects were reversed by treatment with stattic at a dose sufficient to inhibit STAT3. Similarly, the antioxidant tiron also produced the same effects in H9c2 cells. Conclusion: Increased cardiac TGR5 levels in a type-1 diabetes model were related to hyperglycaemia, which produces free radicals to activate STAT3 for the higher expression of TGR5 in the heart. Therefore, an elevation in circulating bile acids from hepatic disorders and/or others shall be handled carefully in diabetic patients.","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"14 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77801543","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Osteomyelitis of the pelvic bones in patients with spinal cord injury: Is magnetic resonance useful for preoperative diagnosis?","authors":"Sgarzani Rossella, T. Sara, F. Trapani, Capirossi Rita, Battilana Micaela, Gaiani Luca, Palmonari Massimo, N. Luca","doi":"10.15761/IMM.1000373","DOIUrl":"https://doi.org/10.15761/IMM.1000373","url":null,"abstract":"Aim of the study: We report a prospective, observational, single-centre study on adult patients with spinal cord injury (SCI) and pressure sores undergoing surgical debridement and reconstruction at Montecatone Rehabilitation Institute from July 2013 to January 2016. The aim is to assess usefulness of magnetic resonance (MR) in pre-operative diagnosis of osteomyelitis. Materials and methods: All the patients underwent preoperative MRI each MRI was evaluated independently by two radiologists and the exam was considered positive for osteomyelitis only when the two radiologists agreed on the diagnosis. All the surgical procedures consisted of a wide debridement of soft and bony tissues and reconstruction: bone specimens were collected and sent for culture and histopathological evaluation. Results of MRI and histopathology were compared. Results: 85 patients were included in the study. The two radiologists working independently agreed on the diagnosis of osteomyelitis in 96% of the cases. Pre-operative MRI was considered positive for osteomyelitis in 45 cases. According to histology, osteomyelitis was diagnosed in 40 patients. MRI findings and histology were concordant in 61% of cases; 19 false positive and 14 false negative cases were found. Sensitivity and specificity of MR in the diagnosis of osteomyelitis were 65% and 58% respectively, with a positive predictive value of 58% and a negative predictive value of 65%. Conclusion: In our cohort sensitivity, specificity, positive predictive value and negative predictive value of MR for the diagnosis of osteomyelitis in patients with SCI and pressure ulcers are lower than previously described. Our findings suggest that MRI cannot be considered a reliable diagnostic technique for the diagnosis of osteomyelitis. We can conclude that MRI is not indispensable pre-operatively in SCI patients with pressure sores, and that all the patient should undergo a wide soft and bony tissues debridement as if they were all affected by osteomyelitis. Histological diagnosis is useful to decide the timing of antimicrobial therapy, that should be planned based on the results of the surgical specimen culture. Further studies are needed to investigate this topic.","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"2016 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"87820091","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Wound coverage by linen dressing accelerate ulcer healing","authors":"Katarzyna Skórkowska Telichowska, Justyna Mierziak, J. Szopa, M. Żuk","doi":"10.15761/imm.1000371","DOIUrl":"https://doi.org/10.15761/imm.1000371","url":null,"abstract":"Volume 6: 1-3 Integr Mol Med, 2019 doi: 10.15761/IMM.1000371 GENE NAME FORWARD PRIMER REVERSE PRIMER NAME SEQUENCE NAME SEQUENCE Homo sapiens histone deacetylase 1 HD1_FP GAGGACTGTCCAGTATTCG HD1_RP GATGCCTCGGACTTCTTT Homo sapiens histone deacetylase 2 HD2_FP ATGAAGCCTCATAGAATCCG HD2_RP GTTATCTGGTCTTATTGACCGT Homo sapiens histone deacetylase 3 HD3_FP ATCGTCTTCAAGCCATACC HD3_RP GAAACACTGGGCAGTCATC Homo sapiens histone deacetylase 8 HD8_FP GGTGACGTGTCTGATGTT HD8_RP GACCACTGCTTTGGGATT Homo sapiens histone acetyltransferase 1 HAT1_FP ATACCTACTCAGTTCTCAGTCCAA HAT1_RP CCACGTCAATAAAGCTAGCA","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"195 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77597021","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Holoprosencephaly, proboscis and anophthalmia in a foetus with matUPD14 and trisomy 13. First case to be diagnosed with hysteroscopy: A case report","authors":"Lalou Iliana, Gkrozou Fani, Eleftherios Meridis, Tsonis Orestis, P. Minas, Syrrou Marika","doi":"10.15761/IMM.1000365","DOIUrl":"https://doi.org/10.15761/IMM.1000365","url":null,"abstract":"","PeriodicalId":94322,"journal":{"name":"Integrative molecular medicine","volume":"20 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2019-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"81157640","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}