I. Amoo, J. Oppong-Kyekyeku, Eric Boakye-Gyasi, S. Asare-Nkansah, J. Adu
{"title":"Quality Control and Anti-Inflammatory Activity of the Stem Bark of Chlorophora regia A. Chev. (Moraceae)","authors":"I. Amoo, J. Oppong-Kyekyeku, Eric Boakye-Gyasi, S. Asare-Nkansah, J. Adu","doi":"10.25026/jtpc.v5i4.311","DOIUrl":"https://doi.org/10.25026/jtpc.v5i4.311","url":null,"abstract":"This study sought to develop a validated reverse-phase high-performance liquid chromatography method for the quality control of the stem bark ingredients and its finished products and investigate the synergistic anti-inflammatory activity of the phytochemical constituents of C. regia stem bark. Fractionation and isolation of biomarkers were carried out by column chromatography on silica gel and monitored by thin-layer chromatography. The isolated biomarkers were characterized based on their melting points and extensive analysis of their spectroscopic data (IR, 1D and 2D NMR). The chromatographic separation was investigated and developed for the analysis of the biomarkers using µBondapakTM C18 (3.9×300 mm, 5 µm) as stationary phase. The mobile phase composition of 0.1 % trifluoroacetic acid as solvent A, and methanol as solvent B with gradient elution was finally selected. The carrageenan-induced edema in a 7-day-old chick model was used to assess the anti-inflammatory activity of the stem bark extract and compared to diclofenac sodium as a reference drug. Two compounds were successfully isolated and identified, as Regiafuran A (1) and 3,5,7,4’-Tetrahydroxy-2’-methoxyflavonol (2). The compounds were employed as biomarkers in the RP-HPLC method development. The developed method was validated and was successfully used to quantify the amount of 1 and 2 in the stem bark to be 0.224% ± 0.056%w/w and 0.354% ± 0.041%w/w respectively. The crude extract showed considerable anti-inflammatory activity compared to the reference drug, diclofenac. The method demonstrated acceptable levels of accuracy, precision, specificity, and robustness hence can be successfully adopted for routine quality control and standardization of the stem bark of C. regia. The stem bark of the plant exhibited significant anti-inflammatory activity.","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-12-18","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"46169028","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Isolation and Evaluation of Antibacterial Potential Test of Plant Carthamus oxycantha","authors":"Amir Hassan, Ibad Ullah, W. Ahmad","doi":"10.25026/jtpc.v5i4.343","DOIUrl":"https://doi.org/10.25026/jtpc.v5i4.343","url":null,"abstract":"The present investigation was initiated to find a suitable alternative to synthetic antibiotics for the management of diseases caused by bacteria. Carthamus oxycantha.L locally known as wild safflower member of family Asteraceae that grows wildly. The study was conducted using as Agar well diffusion to trace the antibacterial potential for to evaluate the efficiency of ethanolic extract of Carthamus oxycantha with concentration of 05, 10, 15, and 20 mg/ml against gram-positive Staphylococcus aureus and gram-negative Escherichia Coli species and them compared with that of Clindamycin, Ampicillin and Kanamycin (10 mg). Zone of inhibition for the extracts were 10.667 to 20.00 mm as compared to standard drug Clindamycin, Ampicillin and kanamycin (15.00-20.00 mm). Antibacterial assays indicates that Carthamus oxycantha has potential natural antimicrobial agents against E-coli and S. aureus. The findings of the present study suggested that ethanolic extract of C. oxycantha has strong potential to serve as possible antibacterial.","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-09-09","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"43046202","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Effectiveness of Antiviral Drugs as Covid-19 Therapy","authors":"Adelia Firandi, D. Hasmono","doi":"10.25026/jtpc.v5i3.291","DOIUrl":"https://doi.org/10.25026/jtpc.v5i3.291","url":null,"abstract":"Introduction: SARS-CoV 2 firstly emerged in China on December 2019 and it was spreading rapidly across the world until now. At this time, there is no vaccine or medication approved by the FDA. However, there are some FDA approved medicines for treating other diseases that can be used for Covid-19 based on tests. This review focuses on therapy efficacy, work mechanism, pharmacokinetic profile, safety, and future perspective. \u0000Method: Article review related to therapy on Covid-19 patients, particularly antiviral therapy which was the combination of lopinavir and ritonavir, chloroquine, hydroxychloroquine, remdesivir, and favipiravir. The reviewed relevant articles were observational study, in vitro test, case report, and clinical test. \u0000Results: A total of 13 articles met the requirement, 9 articles discussed the result of therapy during the medication of COVID-19 patients, 2 reports of in vitro test, and 2 results of clinical trials. \u0000Conclusion: From several studies that had been conducted, remdesivir, combination of lopinavir and ritonavir, as well as favipiravir showed benefits in various clinical studies on Covid-19 patients. Meanwhile, chloroquine and hydroxychloroquine showed limited effects and did not affect the decrease of mortality. \u0000","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"42274050","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
M. Mutmainah, Y. Martono, Ika Puspitaningrum, L. Kusmita
{"title":"Leaf Extract Microencapsulation of Stevia rebaudiana Bert Using Inulin-Chitosan as Anti-Diabetes Diet","authors":"M. Mutmainah, Y. Martono, Ika Puspitaningrum, L. Kusmita","doi":"10.25026/JTPC.V5I3.270","DOIUrl":"https://doi.org/10.25026/JTPC.V5I3.270","url":null,"abstract":"Diabetes mellitus is a collection of symptoms that arise in someone who has increased blood glucose levels. The Stevia plant (Stevia rebaudiana Bert) contains a compound of diterpene glycosides as steviosida and rebaudiosida A. Purified extract of steviosida and rebaudiosida A is widely used as a sweetener for low calorie food and beverage products or as a sugar substitute for diabetics and has the effect of lowering blood sugar levels. This study aims to determine the antidiabetic effect of microencapsulated preparations of Stevia leaf extract (Stevia rebaudiana) with a combination of inulin chitosan encapsulation. Antidiabetic mellitus test was carried out in vivo using test animals of male white rats of Wistar strain. The inducing compound that can cause the condition of diabetes mellitus test animals is Aloxan with a dose of 150 mg / kg Body weight of rats. given intraperitoneally for one day, then the mice were allowed to stand for 3 days to reach a state of diabetes mellitus. Blood glucose levels of test animals were measured on days 1 (initial), 5 (induction) and 12 (treatment) to determine the initial blood glucose levels, after induction of alloxan and after administration of test compounds both CMC Na 0.5% , glibenclamide, and preparations microencapsulation of Stevia leaf extract at a dose of 100; 300; and 700 mg / kg body weight. The results were obtained after 7 days of treatment, it was seen that blood glucose levels in the CMC group remained high, while the Glibenclamid administration group, and the three dosages of microencapsulation preparations of Stevia leaf extract could reduce blood glucose levels. This can be seen from the statistical test that there is a significant difference (p","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"47891951","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Armini Syamsidi, Nuur Aanisah, Reyhan Fiqram, Imanuel Al Jultri
{"title":"Primer Design and Analysis for Detection of mecA gene","authors":"Armini Syamsidi, Nuur Aanisah, Reyhan Fiqram, Imanuel Al Jultri","doi":"10.25026/jtpc.v5i3.297","DOIUrl":"https://doi.org/10.25026/jtpc.v5i3.297","url":null,"abstract":"MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-06-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"41814809","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Fajar Prasetya, S. Salam, Agung Rahmadani, Hadi Kuncoro, Rolan Rusli
{"title":"Chemical constituents from Piper betle L. Var Nigra (Piperaceae)","authors":"Fajar Prasetya, S. Salam, Agung Rahmadani, Hadi Kuncoro, Rolan Rusli","doi":"10.25026/jtpc.v5i3.322","DOIUrl":"https://doi.org/10.25026/jtpc.v5i3.322","url":null,"abstract":"Two fatty acid derivatives, 2-octenoic acid and 2-hexenoic acid were isolated from the extract of n-hexane of the Piper betle L. Var. Nigra (Piperaceae). The chemical structures were identified on the basis of spectroscopic evidence and compared to previously reported spectra. These isolated compounds appear for the first time in the plant.","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-06-29","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"44631916","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Metformin Role in Diabetic Patients with Tuberculosis: a Review","authors":"Esravila Ariya Wibisono","doi":"10.25026/jtpc.v5i3.275","DOIUrl":"https://doi.org/10.25026/jtpc.v5i3.275","url":null,"abstract":"Tuberculosis (TB) epidemic is a global health challenge, and WHO estimated the incidence of the new cases reaching 11.1 million people in 2017. Indonesia is classified as a high TB burden country, with 8% of its population infected by TB and ranks third in the world. Type-2 diabetes mellitus (T2DM) is known comorbidity for TB patients. TB-T2DM patients have a higher chance of morbidity, mortality, relapse, bacterial resistance, treatment failure, and slower sputum conversion than TB patients without T2DM. Recent studies suggest that metformin may have a potential synergistic role for TB-T2DM patients. Metformin has immunomodulator properties that can improve the body's immune response and inflammatory response against TB in individuals with T2-DM.","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-06-28","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"46465389","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Amelia Lorensia, R. V. Suryadinata, Bela C. M. Sidabutar
{"title":"Effect Analysis of Protein Intake of Pedicab Driver in Surabaya","authors":"Amelia Lorensia, R. V. Suryadinata, Bela C. M. Sidabutar","doi":"10.25026/JTPC.V5I3.266","DOIUrl":"https://doi.org/10.25026/JTPC.V5I3.266","url":null,"abstract":"Approximately 64 million people suffer from COPD and 3 million people died because of this disease. No exception to pedicab rickshaw drivers, which is one job that has a high risk of copd. From workplace factors that are always exposed to vehicle fumes and dust pollution and also lifestyles such as smoking habits. Pedal rickshaw drivers are also classified as low economic groups, so their daily food intake is sometimes insufficient, especially the need for protein. Protein intake is very important in COPD, because it can improve the performance of respiratory muscles and improve immune function. This study uses a 24-hour recall method by recording the food taken by respondents in the last 24 hours to see how daily food protein intake. In this study, lung function measurements was performed using a spirometry test where the normal value is if FEV1/FVC> 70%. We Obtained 124 respondents with a total of 62 in the lung function disorder group and 62 non-impaired groups of respondents aged an average of 55-64 years with a history of working as a pedicab driver for approximately 5 years. In the different test the asymp sig has a result of 0.000 where the conclusions in this study as follows: there is a significant difference between daily food protein intake in the pedicab rickshaw driver group with impaired and non-impaired pulmonary function.","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-04-03","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"41913795","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"The Effectiveness of Sea Urchin Extract (Echinometra matthaei) for Wound Healing on Deep Second-Degree in White Rats (Rattus norvegicus) Wistar","authors":"Angelica Kresnamurti, R. DitaNurlita, F. Budiarti","doi":"10.25026/JTPC.V5I3.281","DOIUrl":"https://doi.org/10.25026/JTPC.V5I3.281","url":null,"abstract":"Burns is a form of tissue damage caused by high temperatures. Echinometra matthaei sea urchins have several secondary metabolites that can potentially help in the healing process of burns. In this study, 70% E. matthaei ethanol extract was formulated in the form of O / W (oil in water) type cream preparations which were applied topically. This study aims to determine the effectiveness of E. matthaei ethanol extract cream preparations on the healing of second-degree burns in Wistar strain rats. In this study preparations were made in 3 formulations, namely Formulation 1 (extract concentration of 1%), Formulation 2 (extract concentration of 3%), and Formulation 3 (extract concentration of 5%). This research was conducted for 7 days with the method used is the post-test only control group design. Experiments were given induction of burns using a hot plate with a diameter of 20 mm at a temperature of ± 200oC for 15 seconds. Wound healing is observed periodically by observing macroscopically healing inflammation of the inflammatory phase and observing tissue growth in the proliferation phase. The average percentage of inflammation healing showed improvement in the F2: 100%, F1: 80%, F3: 71% results were better than the wound group: 50% as evidenced by the value α = 0.012 (<0.05) means there are significant differences. The conclusion of this study shows that the ethanol extract of E. matthaei made in cream preparations has the effectiveness of healing of seconddegree burns with a formulation of 3% is best formulation.","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-04-03","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"41616127","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Phytochemical, Proximate, and Vitamin C Content in Morinda citrifolia (Noni)","authors":"S. A. Saah, D. Adu-Poku","doi":"10.25026/JTPC.V5I3.274","DOIUrl":"https://doi.org/10.25026/JTPC.V5I3.274","url":null,"abstract":"Morinda citrifolia, L commonly called noni, has a long history as a medicinal plant and is reported to have a broad range of therapeutic effects, including antibacterial, antiviral, antifungal, antitumor, antihelmin, analgesic, hypotensive, anti-inflammatory, and immune enhancing effects. \u0000Photochemical analyses of ethanol and hexane extracts of noni fruit revealed the presence of flavonoids, terpenoids, alkaloids and steroids. Proximate composition of the noni fruit revealed a moisture content of 54.21, crude protein 2.18, crude fat 3.25, crude fiber 4.49, ash 0.73 and carbohydrate 35.14%. The Vitamin C content was estimated using iodometric titration and found to be 134.10 mg/100g. \u0000This suggests that the noni fruit can if consumed can help promote good health. \u0000","PeriodicalId":17494,"journal":{"name":"Journal of Tropical Pharmacy and Chemistry","volume":null,"pages":null},"PeriodicalIF":0.0,"publicationDate":"2021-02-02","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"45305568","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}