{"title":"Assessment of residual effects of organic manures (Tithonia diversifolia and bat-guano) on maize cultivation in the Ngandajika region in central DR Congo","authors":"Nkongolo Mulambwila Michel","doi":"10.56293/ijasr.2022.5448","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5448","url":null,"abstract":"It has been clearly established that organic matter provides crops with not only nutrients, although in a lower proportion compared to mineral fertilizers, it releases them slowly and gradually. In addition, it also improves the other characteristics of the soil and thus further conditions the fertility of the soil. Consequently, the study of organic manure should not only be limited to the analysis of its effects on the development and yield of crops, it should also extend to the examination of its impact on the maintenance or increasing soil fertility.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"15 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75639012","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Michelle S. Suelo, Aprille Joy M. Luceno 2, Alma B. Mohagan, Reggie Y. Dela Cruz
{"title":"Molecular Identification of Hawkmoths (Lepidoptera: Sphingidae) in Selected Areas of Mt. Kitanglad Based on Cytochrome Oxidase Subunit I (COI) Gene Sequence","authors":"Michelle S. Suelo, Aprille Joy M. Luceno 2, Alma B. Mohagan, Reggie Y. Dela Cruz","doi":"10.56293/ijasr.2022.5505","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5505","url":null,"abstract":"The study was conducted for the identification of selected species of family sphingidae through DNA Barcoding in Mt. Kitanglad Lirongan, Lantapan, Bukidnon, Philippines. Thirteen species were collected namely: Acherontia lachesis, Agrius convolvuli, Ambulyx staudingeri, Amplypterus panopus mindanaoensis, Daphnis hypothous, Gnathothlibus erotus erotus, Hippotion brunneum, Hippotion echeclus, Psilogramma menephron, Theretra nessus, Theretra rhesus, Theretra manilae and Theretra sugii. Isolation of the genomic DNA was carried out using the QIAGEN Blood & Tissue Kit. Mitochondrial cytochrome oxidase (COI) gene amplification was carried out using LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA) primers producing 656-666 base pairs were obtained from 30 samples of sphingid moth species. BLAST analyses were able to identify sphingid to the species level. BLAST hits of COI gene sequence of all 10 species ranged from 95%-99% similarity. Maximum likelihood (ML) and Bayesian inference (BI) was used to examine phylogenetic signals in COI with the highest bootstrap values. Sphingid moths formed a monophyletic group based on the clade.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"10 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"75567419","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Model Indonesian Islamic Banking Consumer Behaviour from the View of Religiosity, Knowledge and Advertising","authors":"Dudi Permana, Rizal Aditya, Hasliza Abdul Halim","doi":"10.56293/ijasr.2022.5473","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5473","url":null,"abstract":"The research aims to identity the sharia bank customer behavior viewed from the perspective of religiosity, knowledge, and advertising. The subjects in this study were people in DKI Jakarta. The sample used in this study was 160 respondents. The sampling technique using a convenience sampling. By using quantitative descriptive approach. Therefore, the analysis of the data used is the statistical analysis in the form of SEM-PLS. The results of this study showed Religiosity has a significant positive effect on the intention to becoming a customer. Knowledge haven’t been a significant effect on the intention to a becoming customer and Advertising has a significant positive effect on the intention to becoming a customer.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"18 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"88152664","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"IMPLEMENTATION OF PROSPECTIVE CIVIL SERVANTS AS PUBLIC SERVICES TO MOVE FASTER, RISE UP STRONGER IN THE DIGITAL ERA TOWARDS SPECIFIC, MEASURABLE, ACHIEVABLE, RELEVANT, AND TIME-BOUND CIVIL SERVANTS","authors":"Monica Henny Sudaryati","doi":"10.56293/ijasr.2022.5446","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5446","url":null,"abstract":"Basic Training for Civil Servant Candidates is held to develop competencies that are carried out in an integrated manner. Procurement of Candidates for Civil Servants at the Ministry of Religion to obtain State Civil Apparatus who have personal characteristics as public service providers, with skills, expertise, and behavior in accordance with the demands of the position for the advancement of the institution. The digital era has brought about changes in prospective Civil Servants to become State Civil Apparatuses that are specific, measurable, achievable, relevant, and time-bound (SMART) This research was conducted at the Jakarta Religious Education and Training Center. The purpose of this study is to determine the implementation of Civil Servant Candidates who become public servants to move faster and rise stronger in the digital era towards a State Civil Apparatus that is Specific, Measurable, Achievable, Relevant, And Time-Bound. This research method is a qualitative approach. Data collection techniques used are observation, interviews and documentation. The results indicate that prospective civil servants already have positions in accordance with the required qualifications and have moved faster in line with the mastery of technology they already have and the speed with which they capture information in the digital era. Increasing self-competence has implications for public servants to build and develop professionalism and SMART of State Civil Apparatus.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"476 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"77888778","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Evaluation of the UV absorbance of sum skin lighting creams","authors":"M. H. Saad","doi":"10.56293/ijasr.2022.5511","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5511","url":null,"abstract":"The results of studies conducted on some skin-lightening creams in the Saudi market indicated that they contain heavy metals in varying proportions that exceed the limits recommended by the World Health Organization, which may cause danger to human health. The study focused on three types of skin-lightening creams, namely Fair & Lovely, Rose, and Diana, to estimate their absorption percentages. In general, the results showed that the relationship between the absorbance rate of skin lightening creams and the wavelength is an inverse relationship, where the absorbance rate decreases with the increase in wavelength. For samples treated with ferment only for skin-lightening creams, the cream with the highest absorption value was Fair & Lovely cream, and the lowest absorption value was Rose cream. In addition, for untreated cream samples, Rose cream had the highest absorption, while Fair & Lovely cream recorded the lowest absorption value. In addition, the samples of creams to which olive oil was added only, without exposure to any other factors, had almost the same absorbance value. Moreover, the samples of creams that were exposed to sunlight varied in their absorbance values, as Rose cream recorded the highest absorption value and Fair & Lovely cream had the lowest absorption value. In the samples of creams that were exposed to X-rays, the results showed that the Diana cream sample and the Rose cream sample had the same pattern and behavior in absorbance.UV spectroscopy (Genesys 10S UV-Vis spectrophotometer) was used.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"15 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"79143368","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
Mealin Grace B. Pacle, Janice Apura, Russel Joy C. Paran, Denis A. Tan
{"title":"A Phenomenological Study of the Lived Experiences of Senior High School Students in Learning Science Subjects in the New Normal","authors":"Mealin Grace B. Pacle, Janice Apura, Russel Joy C. Paran, Denis A. Tan","doi":"10.56293/ijasr.2022.5494","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5494","url":null,"abstract":"Lived experiences from diverse contexts can be transformational in education. Learning science is intertwined with various experiences, which consequently strengthen the formation of a science concept, thereby increasing students' performance in school. Thus, this paper sought to explore the lived experiences of senior high school students in learning science. Based on this concept, the researchers employed the phenomenological technique of qualitative methodologies to collect complex data regarding students' experiences in science subjects in a blended learning environment and to grasp the phenomenon from their perspective. The study revealed four distinct themes in the students' lives: (1) varied experiences of students in learning the science subject during the pandemic, (2) challenges encountered, (3) coping strategies employed, and (4) resources needed in learning science. Based on the findings, the student's learning experiences were affected by the academic experience, motivation, preparedness, and support. The difficulties encountered by learners in learning science subjects during the new normal can be classified as personal, social, mental, and academic difficulties caused by the abrupt transition from face-to-face to blended learning. Teachers and parents are urged to assist the students, and educational resources must be well prepared. Students must also create new and productive study habits to face further endeavors in learning","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"23 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"86161268","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Entrepreneurial Competency Model of Successful Entrepreneur Culinaryin Padang City","authors":"Fisla Wirda, T. Azra, Novirwan Trinanto, Herizon","doi":"10.56293/ijasr.2022.5503","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5503","url":null,"abstract":"This study aims to determine the indicators of entrepreneurial competency and compile the levels of entrepreneurial competency indicators needed from the highest to the lowest level. The research population is the creative industry SMEs in the culinary sector of the city of Padang, with a sample size of 86 managers of the creative industry SMEs in the culinary sector/traditional Padang restaurants, the research location being the city of Padang. This study uses a quantitative approach with the method of SEM and uses Amos as data processing, specifically Second Order Confirmatory Factor Analysis. The results showed the dimensions of entrepreneurial competence needed: conceptual, leadership, learning, opportunity, and personal. The highest level score of the entrepreneurial competence indicator is looking at problems from a positive perspective. The lowest score is recognizing one's strengths and weaknesses and adapting to opportunities and threats. This research is helpful as a reference for indicators of entrepreneurial competency needed for creative industry SMEs in the culinary sector in the city of Padang.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"21 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"82245818","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
M. Aljohani, Ibrahim Binmuhainy, Mohammed Aljarbou, Fahd Algaeed, Noura Abbatain, Norah Almajed
{"title":"The attitudes of Emergency Department consultants toward family presence during resuscitation","authors":"M. Aljohani, Ibrahim Binmuhainy, Mohammed Aljarbou, Fahd Algaeed, Noura Abbatain, Norah Almajed","doi":"10.56293/ijasr.2022.5415","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5415","url":null,"abstract":"Objectives: We assessed the attitudes of emergency department (ED) consultants toward family presence during resuscitation (FPDR), to elucidate and provide proof of the benefits of allowing FPDR in Kingdom of Saudi Arabia. Methods: A cross-sectional descriptive study using a questionnaire electronically sent to all ED consultants from five major government hospitals in Riyadh, Saudi Arabia. The survey examined the consultants' beliefs and perception of FPDR, legalities, policies and the effects and outcomes of FPDR on the patient, family, and themselves. Results: The survey received 172 responses, 55.0% were 36–45 years old and 144 (83.7%) were men. Most respondents (91.36%) had experienced FPDR. Less than half (40.1%) believed that FPDR is beneficial to the patient, and 58.7% believed that FPDR could cause difficulties for the resuscitation team. A written policy for FPDR was preferred by 42% of respondents. Significantly more respondents 36-45 years old recommend allowing FPDR compared to other age groups, and significantly more male consultants in this age group believe there is a positive outcome of FPDR. Conclusion: The attitude and perception of emergency consultants towards the practice of FPDR was less positive than expected. Many consultants did not favor the advantages of FPDR, and were worried about negative outcomes, potential medico-legal repercussions, and the unpleasant experience for the family members, especially female consultants. However, a larger proportion of consultants nevertheless recommend FPDR. The ability of ED doctors to manage FPDR and their understanding of the benefits of FPDR needs to be strengthened.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"41 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"80771268","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"COVID-19: WHAT ARE THE JOURNALIST'S STRATEGIES IN COVERING THE NEWS","authors":"A. Herman, Aulia Ananda Marisa","doi":"10.56293/ijasr.2022.5469","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5469","url":null,"abstract":"This study aims to determine the journalist coverage strategy of Palu City during the Covid-19 by using journalist and journalistic theory, news theory, and the concept of coverage guidelines issued by press organizations. This research method is descriptive and qualitative with an action research approach. The data collection techniques were observation and interviews with four journalists from Palu City. The informants selected through the purposive sampling technique are informants who had been exposed to Coronavirus, have coverage of Covid-19, and have a minimum service period of five years. The study results show that the coverage strategy is divided into three stages. In the first stage, there are two strategies: online research and editorial meetings. In the second stage, the strategies are the technology utilization in communication applications form, the close relationship between journalists and fellow journalists and resources, and utilizing citizen journalism. In the last stage, the strategy generally applies technology because there are no significant obstacles. Of these three stages, there are five coverage strategies, and the most dominant strategy applied during the Covid-19 pandemic is the use of WhatsApp and Zoom Meeting. Furthermore, straight news dominates the Covid-19 news writing model because the rules limit the interview duration.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"120 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"76739747","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}
{"title":"Numerical Algorithm for Solving Optimal Control Problems with Mixed Constraints","authors":"A. T. G., O. O.","doi":"10.56293/ijasr.2022.5517","DOIUrl":"https://doi.org/10.56293/ijasr.2022.5517","url":null,"abstract":": In this research, the numerical solutions of optimal control problems constrained by ordinary differential equation and integral equation are examined. We obtained the numerical solution by applying the “first discretize then optimize” technique. The discretization of the objective function, differential and integral constraints was done using trapezoidal rule, Simpson’s rule and fourth-order Adams-Moulton respectively. Thereafter, the formulated constrained optimization problem was converted into unconstrained problem by applying augmented lagrangian functional. We finally applied the Quasi-Newton algorithm of the Broydon-Fletcher-Goldfrab-Shannon (BFGS) type to obtain our optimal solution. Two examples of optimal control problems constrained by ordinary differential equation and an integral equation are considered. We obtained promising results with linear convergence.","PeriodicalId":13763,"journal":{"name":"International Journal of Applied Science and Engineering Research","volume":"54 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-01-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84090447","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}