European Journal of Clinical Microbiology and Infectious Diseases最新文献

{"title":"A Near Miss of a Retropharyngeal Abscess with MRSA in a 5-Week-Old Boy Due to an Unusual Presentation","authors":"Amanda J. Bastien, Gene C. Liu, Dennis M. Tang, Abhita Reddy, Kyohei Itamura, Jack Green, Priya R. Soni","doi":"10.36519//idcm.2023.241","DOIUrl":"https://doi.org/10.36519//idcm.2023.241","url":null,"abstract":"A retropharyngeal abscess (RPA) in early childhood is not uncommon due to at-risk lymph nodes in this deep neck space and is typified by fever, odynophagia, and a constellation of respiratory manifestations. However, RPA is exceedingly rare in the neonatal subpopulation and not part of the usual differential diagnosis algorithm in this age range. Herein, we present a unique case of a previously healthy 5-week-old male infant with protracted “congestion” and difficulty in oral feeding, whose clinical course is confounded by intermittent, positional bradycardia and subsequent apnea. He was eventually diagnosed with a methicillin-resistant Staphylococcus aureus (MRSA) RPA, leading to concurrent vascular and airways compromise in the form of baroreceptor-mediated bradycardia from mass-effect carotid body compression. This clinical case is an important reminder that any infant with positional vital sign changes should prompt urgent and thorough investigation for extraordinary and otherwise uncommon pathophysiologic states. The case also highlights the power of multidisciplinary collaboration across multiple specialties and parental advocacy in unifying a diagnosis for rare pediatric illnesses. Keywords: deep neck infections, retropharyngeal abscess, MRSA, positional bradycardia, neonatal infection","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"135 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-07-31","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"135315242","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Fluoroquinolone should be reconsidered as empirical therapy for adult inpatient urinary tract infections in tertiary hospital: a perspective descriptive study from the microbiological and cost-effectiveness aspects","authors":"I Ketut Agus Indra Adhiputra, Marta Setiabudy","doi":"10.51559/jcmid.v3i1.47","DOIUrl":"https://doi.org/10.51559/jcmid.v3i1.47","url":null,"abstract":"Background: Urinary Tract Infections (UTI) has become difficult to treat because of its increasing resistance characteristics to antimicrobial agents, especially to fluoroquinolone. The objective of this study was to describe the effectiveness of fluoroquinolone as empirical therapy for adult inpatient UTI. Methods: This descriptive cross-sectional study was performed at Prof. Dr. I.G.N.G. Ngoerah Hospital, a tertiary Hospital in Denpasar, Bali, from January 2020 until March 2020. All urine specimens were examined using bioMérieux VITEK® 2 System. Result: A total of 155 urine samples met the inclusion and exclusion criteria. We found Escherichia coli (39.4%) as the most common microbes followed by Klebsiella pneumoniae (12.3%). Most of the isolates are multi drug resistant organisms (MDRO) (52.9%) and 57% (49) of the Enterobacteriaceae isolates are extended spectrum beta lactamases (ESBLs). The average duration of the empirical antibiotic therapy was 3.7 days for all fluoroquinolone. Ciprofloxacin (53.5%) is the most common empirical therapy, followed by levofloxacin (16.8%). Antimicrobial sensitivity tests showed that bacteria remained highly sensitive to amikacin (96%) and meropenem (94%). The sensitivity test for ciprofloxacin and levofloxacin was only 26% and 4% respectively. The suitability antibiotic results of fluoroquinolone as empirical therapy were only 20% from 110 isolates. The cost ineffectiveness of fluoroquinolone as empirical therapy is Rp.8,402,400 for 3 months. Conclusion: We concluded that both fluoroquinolone (ciprofloxacin and levofloxacin) have a very low sensitivity rate and are not cost-effective, therefore the use of those antimicrobial agents as empirical therapy should be reconsidered.","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"18 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-05-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"136216340","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Severe case of Streptococcus suis meningitis in Bali Mandara Hospital: a case report","authors":"I Wayan Agus Gede Manik Saputra, Indira Chadijah Triatmoko, I Gede Eka Widarmawan, I Gede Hermawan, Putu Dwi Adi","doi":"10.51559/jcmid.v3i1.45","DOIUrl":"https://doi.org/10.51559/jcmid.v3i1.45","url":null,"abstract":"Background: Streptococcus suis meningitis (SSM) is one of the zoonotic disease that can cause serious illness in humans. The major risk factor in many cases of SSM is associated with pig husbandry and consuming undercooked pork products. In Indonesia, especially in Bali, the cases of this acute bacterial meningitis has been strongly correlated with consuming Balinese traditional food called “red lawar”, a mixture of raw pork, fresh pork blood and traditional Balinese herbs. This study aims to report a case of SSM in Bali Mandara Hospital. Case description: A 63-year-old man admitted to the Emergency Department because of a decrease in consciousness (Glasgow coma scale 3/15). This patient was transferred from a private hospital with septic shock and suspicious to acute bacterial meningitis. He had other related symptoms like fever, headache, and cough since two days prior to admission. He also had a history of consuming “red lawar” 2 days before the symptoms appeared. Laboratory findings from cerebrospinal fluid analysis and septic marker indicate the patient had bacterial meningitis. The patient was initially started by Meropenem due to his septic shock. The broad spectrum antibiotics were then de-escalate to Ceftriaxone once the culture and sensitivity test completed and yielded Streptococcus suis. The course of Ceftriaxone as definitive therapy has been administered for 14 days and showed clinical improvement without specific sequelae related to SSM infection like hearing loss. Conclusion: Severe meningitis e.c Streptococcus suis leading to septic shock is a life threatening health condition. Adequate antibiotic therapy and multidisciplinary approach can reduce mortality and morbidity of this case.","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"61 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-05-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"136216339","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Detection of antibacterial activity in chicken meat, eggs, drinking water, animal feed and sewage waste in Tabanan, Bali","authors":"Marta Setiabudy, Anak Agung Gede Indraningrat, Putu Arya Suryanditha, Ni Nyoman Sri Budayanti, Ni Komang Semara Yanti, I Ketut Agus Indra Adhiputra, I Gusti Ayu Rai Widowati, Kadek Karang Agustina","doi":"10.51559/jcmid.v3i1.51","DOIUrl":"https://doi.org/10.51559/jcmid.v3i1.51","url":null,"abstract":"Background: The use of antibiotics that are not in accordance with the indications, doses, and duration can trigger resistance and there is concern that it might leave antibiotic residues in the processed product. Aim of this study was to detect the antibacterial activity of livestock products, namely chicken meat and eggs and the surrounding environment such as drinking water, animal feed and waste disposal. This study was a preliminary study before the establishment of antibiotic wise village, One Health approach for antimicrobial stewardship program. Methods: This study was a descriptive study with a cross sectional design to determine antibacterial activity, particularly tetracycline in livestock products and the environment. The research samples were taken from 5 groups of farmers in one of the villages in Tabanan, Bali. Bioassay method based on the Kirby Bauer method was used in this study. Results: From a total of 44 samples, 6 samples showed weak antibiotic tetracycline activity (13.6%), namely in waste disposal (20%) and animal feed (40%). Antibiotic contamination was likely to occur because the animal feed used in this group contains antibiotics with or without the knowledge of the farmers themselves. Disposal waste came from livestock manure that ate the feed or from animal feed that was scattered around the cage. Conclusion: Samples of livestock meat and eggs did not show antibacterial activity. There were samples that have antibiotic activity but weak and inconsistent, namely in samples of waste disposal and animal feed. This condition cannot necessarily be concluded as antibiotic abuse in livestock however it can be the basis for the importance of providing education regarding antimicrobial resistance. Unless there was indication, antibiotics should not be given to livestock on a daily basis.","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"216 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-05-16","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"136216341","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Prevalence of uropathogen producing extended spectrum beta lactamase (ESBL) at urinary tract infection in chronic kidney disease patients","authors":"Carolin Wijaya, Anselmus Helbert Eriata, I Nengah Tony Rustawan, I Kadek Bayu Adhi Candra, Ni Nyoman Sri Budayanti","doi":"10.51559/jcmid.v3i1.29","DOIUrl":"https://doi.org/10.51559/jcmid.v3i1.29","url":null,"abstract":"Background: Urinary tract infection (UTI) is one of the most common bacterial infections encountered by clinicians in developing countries. UTI in patients with Chronic Kidney Disease (CKD) caused by ESBL-producing gram-negative bacteria has been increased in different countries. The common uropathogenic Gram negative bacteria are Escherichia coli and Klebsiella pneumoniae. The aim of this study was to identify prevalence of the common uropathogen producing ESBL E. coli and K. pneumonia among the patients with urinary tract infection (UTI) in chronic kidney disease as well as the susceptibility of antibiotic therapy. Methods: This was a cross-sectional retrospective study to evaluate clinical urine isolates collected from Prof. Dr. I.G.N.G. Ngoerah Hospital within July 2019 until July 2020. Identification and susceptibility tests in urine isolate were performed by Vitex-2 System (Biomerieux) and interpreted with CLSI 2020 standard. Results: From 1291 urine specimens, 210 urine specimens were collected (29.43%) from patients with UTI in CKD during 12 months. Prevalence of uropathogen in chronic kidney disease from urine specimens were E.coli (41.57%), K.pneumoniae (13.15%), and Pseudomonas aeruginosa (7.36%). It was found that ESBL produced E. coli (56.32%) and also K. pneumoniae (54%). Susceptibility antibiotic E. coli and K. pneumonia of UTI patient with CKD with ESBL producers were meropenem (99,10%), amikacin (98,07%), tigecycline (92,30%), gentamicin (80%), and fosfomycin (79,47%). Conclusion: ESBL producers in patient UTI in CKD patients were E. coli 56,32%, K. pneumoniae 54% that were sensitive to meropenem, amikacin, tigecycline gentamicin, fosfomycin.","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"33 1","pages":"0"},"PeriodicalIF":0.0,"publicationDate":"2023-04-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"135568798","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Using ChatGPT in the Medical Field: A Narrative","authors":"Ali Peksen, C. Gpt","doi":"10.36519/idcm.2023.227","DOIUrl":"https://doi.org/10.36519/idcm.2023.227","url":null,"abstract":"This text was written by filtering the response of ChatGPT to our querries.\u0000\u0000ChatGPT has jumped into many fields including the scientific arena. It seems that there could be benefits of this application, however there is a huge area that could be misused. We optimistically focused on the positive sides to inform our readers, and decided to ask ChatGPT to talk about itself.","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"427 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2023-03-11","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"79254588","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Prof. Kenan Midilli, MD: Great Virologist, Brilliant Scientist, and Passionate Intellectual (1963-2022)","authors":"O. Ergonul","doi":"10.36519/idcm.2022.201","DOIUrl":"https://doi.org/10.36519/idcm.2022.201","url":null,"abstract":"","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"32 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-12-21","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"85841249","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"An Unusual Cause of Acute Isolated Hepatitis in a Cancer Patient Post-COVID Pneumonia: HSV-2","authors":"Türkkan Öztürk-Kaygusuz, A. Sagmak-Tartar, A. Akbulut","doi":"10.36519//idcm.2022.117","DOIUrl":"https://doi.org/10.36519//idcm.2022.117","url":null,"abstract":"","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"1 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"89673087","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Novel SARS-CoV-2 Omicron variants in İstanbul; Rapid Preponderance of BA.2 and BA.5","authors":"Yesim Tuyji-Tok, Ebru Yücebag, Ayse Betül Keles, A. Kılınçarslan, O. Nohut, Seda Salman-Yılmaz, M. Kuşkucu, K. Midilli","doi":"10.36519//idcm.2022.143","DOIUrl":"https://doi.org/10.36519//idcm.2022.143","url":null,"abstract":"Objective: In Turkey, the fourth wave of SARS-CoV-2 started in December 2021 and peaked in mid-January 2022. Afterward, peaks were seen in the number of COVID-19 cases because of Omicron BA.2 and BA.5 variants. Our study aimed to observe the prevalence and viral load-re-lated transmissibility rates of the Omicron BA.2 and BA.5 variant infections in our region be-tween January 21 and July 01, 2022, using an easy and cost-effective PCR screening method. Methods: The frequency of BA.2 and BA.5 were determined by the two-stage allele-specific and drop-out RT-PCR method targeting NSP6 105-107del, spike 69-70del, and spike L452R mutation-specific primers. Transmissibility of the Omicron variants was assessed using cycle threshold (Ct) values (a proxy for SARS-CoV-2 viral load and infectivity). Also, using the next generation sequencing (NGS) method, existing mutations were analyzed by generating full-length sequences of the representative, randomly selected samples from the Omicron variants determined by PCR screening test. Results: We defined the first case of BA.2 on January 19, 2022, in İstanbul University-Cerrahpaşa School of Medicine COVID-19 Molecular Diagnosis Laboratory. Following this, it was observed that BA.1 lost its dominance due to the increased transmissibility of BA.2. On May 5, we defined the first case of BA.5, and as of July this Omicron variant rapidly became preponderant, with a frequency of more than 85%. Compared with BA.1, BA.2 and BA.5 were associated with 2.82 (95% CI: 2.33-4.12) and 2.49 (95% CI: 2.16-3.55) fewer cycles, respectively, meaning higher transmissibility. As confirmed by the NGS results, it was concluded that screening with NSP6 105-107del, spike 69-70del and spike L452R mutation targeted PCR method, which is used uniquely in our hospital in Turkey, can be an easy and cost-effective method in the follow-up of Omicron variants. Conclusion: The higher viral load detection in infections with BA.2 and BA.5 reflects a prolonged disease period, and increased transmissibility, so rapid expansion of these Omicron variants in Turkey is inevitable. Even though the prevalence of the Omicron variants in the population can be monitored in near real-time by the PCR screening method, more sequencing studies are needed for the early identification of new mutations that will emerge.","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"73 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-09-26","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84267727","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates","authors":"Titiek Sulistyowati, Soedarsono, N. Mertaniasih","doi":"10.51559/jcmid.v2i1.18","DOIUrl":"https://doi.org/10.51559/jcmid.v2i1.18","url":null,"abstract":"ABSTRACT\u0000Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination.\u0000Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia.\u0000Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing.\u0000Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180.\u0000Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.","PeriodicalId":11964,"journal":{"name":"European Journal of Clinical Microbiology and Infectious Diseases","volume":"65 1","pages":""},"PeriodicalIF":0.0,"publicationDate":"2022-06-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"84754221","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":0,"RegionCategory":"","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}