医学最新文献

{"title":"Can a lack of knowledge of the ovulatory cycle result in primary infertility? Evidence from selected South Asian countries.","authors":"Pratyashee Ojah, Manas Ranjan Pradhan","doi":"10.1080/14647273.2024.2441832","DOIUrl":"https://doi.org/10.1080/14647273.2024.2441832","url":null,"abstract":"<p><p>Knowledge of ovulatory cycle (KOC) is a crucial factor for successful conception. Despite sizable number of women suffering from infertility, empirical evidence on the relation between infertility and KOC is rare in South Asia. This study assesses the association between primary infertility and KOC. The data of ever-married women aged 20-49 gathered in the recent rounds of Demographic and Health Survey (DHS) for India (2019-2021), Bangladesh (2017-2018), Pakistan (2017-2018) and Nepal (2022) were analyzed. Bivariate analysis and binary logistic regression were conducted through Stata (V.17) with a 5% significance level. Women with no KOC in India [AOR:1.71, C.I.: (1.54, 1.9)] and Bangladesh [AOR:2.6, C.I.: (1.67, 4.06)] had higher odds of primary infertility than their counterparts with correct KOC. The study concludes that correct KOC is a significant predictor of primary infertility in India and Bangladesh and is insignificant in Pakistan and Nepal. Moreover, higher age at marriage and no-visit to healthcare facility were the other significant predictors of primary infertility in all four countries. Women who are struggling to conceive would benefit from education related to the timing and identification of the fertile window, which may be provided through primary healthcare providers.</p>","PeriodicalId":13006,"journal":{"name":"Human Fertility","volume":"28 1","pages":"2441832"},"PeriodicalIF":2.1,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142863741","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"COVID-19 vaccine knowledge and acceptance among the Libyan population: A cross-sectional study.","authors":"Rana H Shembesh, Mohammed S Beshr, Mariam M ALTarhouni","doi":"10.1080/21645515.2024.2439590","DOIUrl":"https://doi.org/10.1080/21645515.2024.2439590","url":null,"abstract":"<p><p>We aim to identify Libyans' knowledge, attitudes, and acceptance regarding the COVID-19 vaccine. A cross-sectional survey was electronically distributed to the Libyan population aged 18 and older between May and September 2023. The questionnaire had three sections: socio-demographics, COVID-19 vaccination and infection, and knowledge and attitudes toward the COVID-19 vaccine. The chi-square test was used to assess the associations. A total of 1,043 respondents completed the questionnaire. Of these, 590 (56.6%) were vaccinated, and 453 (43.4%) were unvaccinated. Only age, educational level, employment status, history of COVID-19 infection, and source of information had a significant association with vaccination status; all shared a p-value <.05. However, Monthly income did not. Regarding knowledge, 63.7% agreed that vaccines in general are an effective way to prevent and control infectious diseases, and 76.6% agreed that they can prevent disease and mortality. However, regarding COVID-19 vaccine, 48.4% agreed that the benefits outweigh the risks. Regarding COVID-19 safety, 40.8% responded that COVID-19 vaccines are only slightly safe or not safe at all. COVID-19 vaccine acceptance was at 57.2%, and only age and source of information were significantly associated. Those who held favorable views were more likely to accept the vaccine, while those who had concerns about safety were more vaccine hesitant. There is a gap between the perception of the COVID-19 vaccine compared to other vaccines among Libyans. Our study revealed that 57.2% of Libyans accept the COVID-19 vaccine. However, only 34% of the Libyan population is vaccinated. A comprehensive health policy is needed.</p>","PeriodicalId":49067,"journal":{"name":"Human Vaccines & Immunotherapeutics","volume":"21 1","pages":"2439590"},"PeriodicalIF":4.1,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142865640","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Malnutrition defined by Controlling Nutritional Status score was independently associated with prognosis of diffuse large B-cell lymphoma primarily on elderly patients.","authors":"Fei Wang, Luo Lu, Haoyu Zang, Yanhua Yue, Yang Cao, Min Chen, Yue Liu, Weiying Gu, Bai He","doi":"10.1080/16078454.2024.2434276","DOIUrl":"https://doi.org/10.1080/16078454.2024.2434276","url":null,"abstract":"<p><strong>Objectives: </strong>Controlling Nutritional Status (CONUT) Score is an effective tool for the assessment of malnutrition and proved to be associated with survival of Diffuse large B-cell lymphoma (DLBCL) patients. We investigated the impact of CONUT score on specific subgroups of DLBCL patients, including age and International prognostic Index (IPI) risk groups.</p><p><strong>Methods: </strong>Data of 287 newly diagnosed DLBCL in the Third Affiliated Hospital of Soochow University were retrospectively collected. Baseline CONUT score, clinical data and survival information were recorded.</p><p><strong>Results: </strong>With the standard cut-off value of 4 points, 88 (30.7%) patients were clarified as malnourished. During a median follow-up of 34 months, malnourished patients exhibited significant reduction in both progression-free survival (PFS) and overall survival (OS). The 3-year PFS rates for malnourished and well-nourished patients were 51.4% and 70.9% (<i>p</i> = 0.001), while the 3-year OS rates were 62.4% and 84.0% (<i>p</i> < 0.001). Malnutrition was demonstrated an independent predictor of OS in DLBCL patients (HR 2.220, 95% CI 1.307-3.772, <i>p</i> = 0.003). It could effectively identify patients with inferior OS in both low/intermediate-low risk and intermediate-high/high risk IPI groups. In the group of elderly patients aged over 60 years, malnutrition was independently associated with OS (HR 2.182, 95% CI 1.178-4.040, <i>p </i>= 0.024), but not PFS (HR 1.709, 95% CI 1.016-2.875, <i>p</i> = 0.070) after adjustment using the Benjamini-Hochberg procedure. Conversely, for younger patients, malnutrition did not demonstrate an independent impact on either PFS or OS.</p><p><strong>Conclusion: </strong>Malnutrition evaluated by CONUT score was an independent predictor for the outcome of DLBCL patients, which is exclusively caused by its effect on elderly patients.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2434276"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142852916","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Daurisoline inhibits glycolysis of lung cancer by targeting the AKT-HK2 axis.","authors":"Shi-Ming Tan, Lan Luo, Yi-Fu He, Wei Li, Xin-Xing Wan","doi":"10.1080/15384047.2024.2442556","DOIUrl":"https://doi.org/10.1080/15384047.2024.2442556","url":null,"abstract":"<p><p>Lung cancer, one of the most prevalent tumors, remains a clinical challenge with a poor five-year survival rate. Daurisoline, a bis-benzylisoquinoline alkaloid derived from the traditional Chinese herb Menispermum dauricum, is known to suppress tumor growth effectively. However, its precise mechanism of action remains unclear. In this study, we demonstrate that Daurisoline targets glycolysis and reduces the protein level of HK2, thereby inhibiting lung cancer progression. Mechanistic investigations reveal that Daurisoline directly binds to AKT and antagonizes the AKT-GSK3β-c-Myc-HK2 signaling axis. Furthermore, in an animal model, we validate the in vivo anti-tumor effect of Daurisoline without any observable side effects. Overall, our findings suggest that Daurisoline holds potential as an anti-tumor agent through its targeting of glycolysis.</p>","PeriodicalId":9536,"journal":{"name":"Cancer Biology & Therapy","volume":"26 1","pages":"2442556"},"PeriodicalIF":4.4,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142853197","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML.","authors":"Yi-Zi Liu, Feng-Hong Zhang, Chun-Xiao Hou, Zhi-Yu Zhang, Yi-Yan Zhu, Qian Wang, Yu Chen, Su-Ning Chen","doi":"10.1080/16078454.2024.2439110","DOIUrl":"https://doi.org/10.1080/16078454.2024.2439110","url":null,"abstract":"<p><strong>Objective: </strong>Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While <i>MTCP1</i> is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the <i>GATAD2B::MTCP1</i> fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).</p><p><strong>Methods: </strong>The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The <i>GATAD2B::MTCP1</i> fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (<i>GATAD2B</i>-F: CCTCTTTTTTTCGACGCC; <i>MTCP1</i>-R: ACTGAGCACAACACTTACGC).</p><p><strong>Results: </strong>The <i>GATAD2B::MTCP1</i> fusion results from a breakpoint on 1q21 within <i>GATAD2B</i> exon 1 and Xq28 within <i>MTCP1</i> exon 2. The patient with the <i>GATAD2B::MTCP1</i> fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.</p><p><strong>Conclusions: </strong>We propose that the <i>GATAD2B::MTCP1</i> fusion upregulates <i>MTCP1</i> expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.</p>","PeriodicalId":13161,"journal":{"name":"Hematology","volume":"30 1","pages":"2439110"},"PeriodicalIF":2.0,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142854224","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Association between salivary /microbiological parameters, oral health and eating habits in young athletes.","authors":"Domenico Tripodi, Alessia Cosi, Rosita Valloreo, Domenico Fulco, Marco Tieri, Lavinia Alberi Auber, Simonetta D'Ercole","doi":"10.1080/15502783.2024.2443018","DOIUrl":"https://doi.org/10.1080/15502783.2024.2443018","url":null,"abstract":"<p><strong>Background: </strong>Athletes' oral health can impact overall well-being and sports performance. This study aimed to evaluate the interactions between eating habits and oral health of 120 young athletes as compared to 30 age-matched individuals not practicing sports based on a questionnaire and the analysis of saliva.</p><p><strong>Methods: </strong>One hundred twenty subjects practicing various sports activities (test group) and 30 subjects not practicing sports (control group) were selected. A self-administered questionnaire was used to obtain personal data, hours and frequency of weekly training, complete pathological history, history of hard and soft tissues of the oral cavity, family history, and oral hygiene practices. The eating habits of the young participants were analyzed by investigating the number of daily meals; use and frequency in sports practice of supplements/energy drinks, fruit/juices, snacks, chocolate; daily diet; and differences between usual diet and pre-competition diet. At baseline (T0), each participant was clinically assessed for the determination of the number of decayed, missing, and filled teeth (DMFT), Silness & Löe Plaque Index (PI), and the Löe & Silness Gingival Index (GI) and qualitative analysis for the presence/absence of stains and dental erosions. At T0, before (T1) and after training sessions (T2), saliva was collected to determine resting pH, <i>Streptococcus mutans</i>, and <i>Lactobacillus</i> spp counts.</p><p><strong>Results: </strong>Test groups were trained more than 2 h, 5 times a week. Soccer players and skiers had a high percentage of caries; water polo players demonstrated the highest percentage of erosions and dental stains. Salivary resting pH showed statistically different values in three different observations between the groups. <i>S. mutans</i> was harbored by 60% of soccer and 70% of water polo players, while <i>Lactobacillus</i> spp in 43.33% of the swimmers and soccer players. Combining all the 56 variables including the clinical examination, self-reported parameters, and salivary analysis, we have identified water polo players as a distinct at-risk group for developing dental defects, expressed as an aggregate disease score. In particular, we have found that energy snacks/chocolate intake is strongly associated with ratio of <i>S. mutans</i>/<i>Lactobacillus</i> spp and that <i>S. mutans</i> is linked to dental defects (<i>R</i> = 0.88). Linear regression analysis indicates that energy snacks/chocolate intake in the study population represents a strong driver for oral dysbiosis and dental disease.</p><p><strong>Conclusions: </strong>Our study clearly shows that athletes should follow a balanced diet that not only satisfies their nutritional needs but also avoids oral dysbiosis and subsequent dental damage.</p>","PeriodicalId":17400,"journal":{"name":"Journal of the International Society of Sports Nutrition","volume":"22 1","pages":"2443018"},"PeriodicalIF":4.5,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142854633","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Investigation of the effect of nitrate and L-arginine intake on aerobic, anaerobic performance, balance, agility, and recovery in elite taekwondo athletes.","authors":"Zafer Kavcı, Murat Ozan, Yusuf Buzdağlı, Adem Savaş, Halil Uçar","doi":"10.1080/15502783.2024.2445609","DOIUrl":"https://doi.org/10.1080/15502783.2024.2445609","url":null,"abstract":"<p><strong>Background: </strong>Taekwondo is a complex martial art that requires speed, balance, agility, and endurance. This study aims to examine the effects of nitrate and L-arginine supplementation on acute aerobic and anaerobic performance, balance, agility, and recovery in elite taekwondo athletes.</p><p><strong>Method: </strong>This study was conducted as a double-blind, randomized, crossover study with the participation of 15 experienced taekwondo athletes aged 19.06 ± 0.96 years and 8.93 ± 1.27 years of training experience. Participants visited the laboratory a total of nine times, including a practice session and anthropometric measurements. These visits consisted of eight experimental sessions conducted at 72-hour intervals. The experimental sessions were conducted with nitrate, L-arginine, and a combination of both supplements (NIT*L-ARG) and placebo. Nitrate supplementation was provided by homogenizing fresh spinach (837.40 mg/kg), while L-ARG was given as a single dose of 6 g in powder form three hours before exercise.</p><p><strong>Results: </strong>NIT*L-ARG supplementation significantly improved the anaerobic performance of athletes in Wingate peak power and peak power (w/kg) compared to placebo and in mean power compared to NIT, L-ARG, and PLA. In addition, NIT*L-ARG supplementation significantly improved blood lactate levels and agility performance immediately after Wingate and Shuttle run tests.</p><p><strong>Conclusion: </strong>The combined intake of NIT*L-ARG was found to be effective in improving aerobic, anaerobic, and agility performances as well as fatigue levels of athletes. It was determined that taking NIT and L-ARG supplements alone contributed to the improvement of improving athletes' performance in Wingate mean power values and subsequent fatigue level compared to PLA.</p>","PeriodicalId":17400,"journal":{"name":"Journal of the International Society of Sports Nutrition","volume":"22 1","pages":"2445609"},"PeriodicalIF":4.5,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142877637","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Long-term effects of neoadjuvant chemotherapy in variant histology locally advanced colon cancer: a propensity score-matched analysis.","authors":"Qiancheng Wang, Shiyang Jin, Zeshen Wang, Yuming Ju, Kuan Wang","doi":"10.1080/15384047.2024.2441511","DOIUrl":"https://doi.org/10.1080/15384047.2024.2441511","url":null,"abstract":"<p><strong>Purpose: </strong>Neoadjuvant chemotherapy (NAC) has proven valuable in treating locally advanced colon cancer (LACC) and is included as a treatment option for patients with clinical T4b colon cancer by the National Comprehensive Cancer Network. However, the long-term survival benefit of NAC in LACC remains debated, due to a lack of conclusive clinical trial results identifying the patients who would benefit most from NAC. This study aimed to assess the efficacy of NAC in patients with LACC based on histological subtype.</p><p><strong>Patients and methods: </strong>This retrospective study analyzed 3,709 patients with LACC who underwent curative resection at Harbin Medical University Cancer Hospital between 2014 and 2018. Patients were grouped into two groups: neoadjuvant chemotherapy (NAC) and adjuvant chemotherapy (AC) groups. Propensity score matching (PSM) was used to adjust for confounders, and survival outcomes of the two groups across different histological subtypes were evaluated using Kaplan-Meier (K-M) curves and log-rank tests.</p><p><strong>Results: </strong>Patients with non-mucinous adenocarcinoma (NMAC) treated with NAC had a significantly improved 5-year OS rate (76.3% vs. 69.2%, <i>p</i> = .039) and DFS rate (67.2% vs. 60.1%, <i>p</i> = .041) compared with patients treated with AC. However, there was no significant difference in OS and DFS between the two treatment groups among patients with mucinous adenocarcinoma (MAC) and signet ring cell carcinoma (SRCC).</p><p><strong>Conclusion: </strong>In patients with LACC, the prognostic value of NAC varied by histology. NMAC may serve as a predictor of improved long-term survival benefit from NAC in these patients.</p>","PeriodicalId":9536,"journal":{"name":"Cancer Biology & Therapy","volume":"26 1","pages":"2441511"},"PeriodicalIF":4.4,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142881134","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Induction of cell death in malignant cells and regulatory T cells in the tumor microenvironment by targeting CD137.","authors":"Rui Sun, Kang Yi Lee, Yu Mei, Emily Nickles, Jia Le Lin, Runze Xia, Haiyan Liu, Herbert Schwarz","doi":"10.1080/2162402X.2024.2443265","DOIUrl":"https://doi.org/10.1080/2162402X.2024.2443265","url":null,"abstract":"<p><p>Regulatory T cells (Tregs) contribute significantly to the immunosuppressive nature of the tumor microenvironment which is a main barrier for immunotherapies of solid cancers. Reducing Treg numbers enhances anti-tumor immune responses but current depletion strategies also impair effector T cells (Teffs), potentially leading to reduced anti-tumor immunity and/or autoimmune diseases. CD137 has been identified as the most differentially expressed gene between peripheral Tregs and intratumoral Tregs in virtually all solid cancers. Further, CD137 is expressed by malignant cells of certain cancers, making it a potential target for tumor immunotherapy. Here, we report the development of a fully human anti-human CD137 antibody of the IgG1 isotype, clone P1A1, that induces antibody-dependent cell-mediated cytotoxicity (ADCC) in CD137⁺ Tregs and cancer cells. P1A1 cross-reacts with murine CD137 which allowed testing murine chimeric P1A1 in syngeneic murine tumor models where P1A1 significantly reduced the number of CD137⁺ Tregs and inhibited tumor growth in a murine hepatocellular carcinoma (HCC) and a melanoma lung metastasis model. P1A1 can also be internalized thus enabling it as a carrier for drugs to target CD137⁺ Tregs and cancer cells. These anti-cancer properties suggest a translation of P1A1 to human immunotherapy.</p>","PeriodicalId":48714,"journal":{"name":"Oncoimmunology","volume":"14 1","pages":"2443265"},"PeriodicalIF":6.5,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142883138","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Statement of Retraction: A sandwich technique (N&H variation technique) to reduce blood loss during cesarean delivery for complete placenta previa: a randomized controlled trial.","authors":"","doi":"10.1080/14767058.2025.2440150","DOIUrl":"https://doi.org/10.1080/14767058.2025.2440150","url":null,"abstract":"","PeriodicalId":50146,"journal":{"name":"Journal of Maternal-Fetal & Neonatal Medicine","volume":"38 1","pages":"2440150"},"PeriodicalIF":1.7,"publicationDate":"2025-12-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142808470","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}