生命科学最新文献

{"title":"Homocysteine S-Methyltransferase 3 Positively Regulates Cadmium Tolerance in Maize.","authors":"Kaina Lin, Kewen Xu, Yiqing Chen, Yifan Lu, Meixue Zhou, Fangbin Cao","doi":"10.1111/pce.15244","DOIUrl":"https://doi.org/10.1111/pce.15244","url":null,"abstract":"<p><p>The increasing contamination of agricultural soils with cadmium (Cd) poses a significant threat to human health and global food security. Plants initiate a series of mechanisms to reduce Cd toxicity. However, the response of maize to Cd toxicity remains poorly understood. In this study, we identified that ZmHMT3, which encodes a homocysteine S-methyltransferases family protein, acted as a regulator of Cd tolerance in maize. Subcellular localization and in situ PCR exhibited that ZmHMT3 was localized in the cytoplasm and predominantly expressed in the phloem. Overexpression of ZmHMT3 enhanced Cd tolerance and reduced Cd concentration in both shoots and roots. In contrast, ZmHMT3 mutants attenuated Cd tolerance but did not change shoot Cd concentration. Heterologous overexpression of ZmHMT3 in rice enhanced Cd tolerance and reduced grain Cd concentration. Transcriptome analysis revealed that ZmHMT3 upregulated the expression of stress-responsive genes, especially glutathione S-transferases (GSTs) and transcription factors, including MYBs, NACs and WRKYs, and modulates the expression of different ATP-binding cassette (ABC) transporters, thereby enhancing Cd tolerance. Collectively, these findings highlight the pivotal role of ZmHMT3 in Cd tolerance and as a candidate gene for improving Cd tolerance in elite maize varieties.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.0,"publicationDate":"2024-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142556556","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Fast and simple fluorometric measurement of phloem loading exposes auxin-dependent regulation of Arabidopsis sucrose transporter AtSUC2.","authors":"Yunjuan Ren, Ziyu Zhang, Diana Zhanakhmetova, Wenhui Li, Shaolin Chen, Tomáš Werner, Johannes Liesche","doi":"10.1111/tpj.17110","DOIUrl":"https://doi.org/10.1111/tpj.17110","url":null,"abstract":"<p><p>The rate of sucrose export from leaves is a major factor in balancing whole-plant carbon and energy partitioning. A comprehensive study of its dynamics and relationship to photosynthesis, sink demand, and other relevant processes is hampered by the shortcomings of current methods for measuring sucrose phloem loading. We utilize the ability of sucrose transporter proteins, known as SUCs or SUTs, to specifically transport the fluorescent molecule esculin in a novel assay to measure phloem loading rates. Esculin was administered to source leaves and its fluorescence in the leaf extract was measured after 1 or 2 h. Dicot plants with an active phloem loading strategy showed an export-dependent reduction of esculin fluorescence. Relative leaf esculin export rates correlated with leaf export rates of isotopic carbon and phloem exudate sucrose levels. We used esculin experiments to examine the effects of phytohormones on phloem loading in Arabidopsis, showing, for example, that auxin induces phloem loading while cytokinin reduces it. Transcriptional regulation of AtSUC2 by AUXIN RESPONSE FACTOR1 (ARF1) corroborated the link between auxin signaling and phloem loading. Unlike established methods, the esculin assay is rapid and does not require specialized equipment. Potential applications and limitations of the esculin assay are discussed.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.2,"publicationDate":"2024-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142562627","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.","authors":"Runnan Zhou, Sihui Wang, Jianwei Li, Mingliang Yang, Chunyan Liu, Zhaoming Qi, Chang Xu, Xiaoxia Wu, Qingshan Chen, Ying Zhao","doi":"10.1111/pce.15250","DOIUrl":"https://doi.org/10.1111/pce.15250","url":null,"abstract":"<p><p>Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.0,"publicationDate":"2024-11-01","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142556557","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"The Critical Roles of Phosphatidylethanolamine-Binding Proteins in Legumes.","authors":"Tong Su, Yichun Wu, Chao Fang, Baohui Liu, Sijia Lu, Fanjiang Kong, Huan Liu","doi":"10.1111/pce.15255","DOIUrl":"https://doi.org/10.1111/pce.15255","url":null,"abstract":"<p><p>Legumes, characterized by their ability to form symbiotic relationships with nitrogen-fixing bacteria, play crucial roles in agriculture, ecology and human nutrition. Phosphatidylethanolamine-binding proteins (PEBPs) are the key genetic players that contribute to the diverse biological functions of legumes. In this review, we summarize the current understanding of important roles of PEBP genes in legumes, including flowering, inflorescence architecture, seed development and nodulation. We also delve into PEBP regulatory mechanisms and effects on plant growth, development, and adaptation to the environment. Furthermore, we highlight their potential biotechnological applications for crop improvement and promoting sustainable agriculture. This review emphasizes the multifaceted roles of PEBP genes, shedding light on their significance in legume biology and their potential for sustainable productive farming.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.0,"publicationDate":"2024-10-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142542422","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Exit control: the role of Arabidopsis hydathodes in auxin storage and nutrient recovery","authors":"Gwendolyn Kirschner","doi":"10.1111/tpj.17118","DOIUrl":"10.1111/tpj.17118","url":null,"abstract":"&lt;p&gt;Hydathodes are organs on the leaves of all vascular plants. They regulate the secretion of fluids derived from the xylem sap (Bellenot et al., &lt;span&gt;2022&lt;/span&gt;; Cerutti et al., &lt;span&gt;2019&lt;/span&gt;). When stomata are closed at night and the humidity level levels are too high, the xylem delivers excess water from the roots, which is secreted at the hydathodes in a process called guttation (Figure 1a) (Singh, &lt;span&gt;2020&lt;/span&gt;). Hydathodes are composed of an epidermal surface layer with water pores, and an inner parenchyma, called the epithem, which is highly vascularized and constitutes a direct connection between leaf surface and xylem vessels (Figure 1b) (Bellenot et al., &lt;span&gt;2022&lt;/span&gt;). Hydathodes were first described by the German botanist Anton de Bary in 1877, and named by the Austrian botanist Gottlieb Haberlandt in 1897, from the Greek ‘hyda’ (water) and ‘hodos’ (way) (Bellenot et al., &lt;span&gt;2022&lt;/span&gt;). When Jean-Marc Routaboul, the corresponding author of the highlighted publication, joined Laurent Noël's team at INRAE, France, in 2018, he was surprised to find that hydathodes and the process of guttation were not well understood at the molecular level. Therefore, Routaboul and his colleagues set out to test two long-standing hypotheses about hydathodes: that hydathodes are sites of auxin accumulation, and that they facilitate the withholding of nutrients from guttation fluids (Routaboul et al., &lt;span&gt;2024&lt;/span&gt;).&lt;/p&gt;&lt;p&gt;These hypotheses are based on genes expressed in hydathodes, including those for auxin biosynthesis, transport, and signalling. Moreover, the presence of auxin in hydathodes was detected by antibodies and by using the auxin signalling reporter &lt;i&gt;DR5&lt;/i&gt; (Aloni et al., &lt;span&gt;2003&lt;/span&gt;). Other hydathode-specific genes encode membrane transporters for amino acids, sugar or ions (Nagai et al., &lt;span&gt;2013&lt;/span&gt;), potentially preventing nutrient loss through guttation. For their study, Routaboul &lt;i&gt;et al&lt;/i&gt;. combined RNAseq of hydathode-enriched tissue by deep sequencing with a detailed metabolomic analysis of guttation fluids.&lt;/p&gt;&lt;p&gt;First, the authors compared the transcriptome of macro-dissected leaf margins containing hydathodes with the transcriptome of leaf blade tissue of mature Arabidopsis leaves. They found higher expression of genes related to auxin metabolism, stress, DNA, plant cell wall, transport, RNA and lipids in the hydathode-enriched tissue. Genes related to glucosinolate synthesis and transport, the sulfation pathway, metal handling or photosynthesis were more highly expressed in the leaf blade. Because many genes related to auxin biosynthesis were expressed in hydathodes, the authors measured the accumulation of free auxin in hydathode-enriched tissue and leaf blades with liquid chromatography/mass spectrometry (LC/MS) and found nearly 40% more free auxin in hydathode-enriched tissue than in leaf blades. Reporter gene expression confirmed that genes encoding the key auxin biosynthetic enzymes Tryp","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":"120 3","pages":"855-856"},"PeriodicalIF":6.2,"publicationDate":"2024-10-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"https://onlinelibrary.wiley.com/doi/epdf/10.1111/tpj.17118","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142542443","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"OA","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Ethylamine, beyond the synthetic precursor of theanine: CsCBF4-CsAlaDC module promoted ethylamine synthesis to enhance osmotic tolerance in tea plants.","authors":"Ziwen Zhou, Xiangzong Luo, Maoyin Fu, Siya Li, Yaohua Cheng, Yeyun Li, Xianchen Zhang","doi":"10.1111/tpj.17089","DOIUrl":"https://doi.org/10.1111/tpj.17089","url":null,"abstract":"<p><p>The tea plant (Camellia sinensis) is a perennial green plant, and its tender leaves are rich in secondary metabolites, such as theanine. Ethylamine (EA), a small amine, is an important prerequisite for theanine synthesis. However, beyond its involvement in theanine synthesis, the other physiological functions of EA in tea plants remain unknown. In vitro experiments indicate that EA may function as scavengers of reactive oxygen species (ROS) to protect the plant against damage caused by osmotic stress. Additionally, a significant correlation between EA levels and osmotic tolerance has been observed in different tea varieties. From the results, alanine decarboxylase (CsAlaDC)-silenced tea leaves and overexpressed CsAlaDC Arabidopsis thaliana lines decreased and increased EA levels, respectively, and mediated ROS homeostasis, thus exhibiting a sensitive and tolerant phenotype. In addition, the transcription factor (TF) CsCBF4 was functionally identified, which can directly bind to the CsAlaDC promoter. CsCBF4-silenced tea leaves significantly reduced the expression levels of CsAlaDC and in turn EA content, resulting in excess ROS accumulation and an osmotic-sensitive phenotype. Taken together, these results established a new regulatory module consisting of CBF4-CsAlaDC responsible for EA accumulation and ROS homeostasis in response to osmotic stress.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.2,"publicationDate":"2024-10-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142542438","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Altered immunophenotypic expression in the peripheral bladder cancer immune landscape","authors":"Nathan J Mackenzie,&nbsp;Kate Zimmermann,&nbsp;Clarissa Nicholls,&nbsp;Mahasha PJ Perera,&nbsp;Alexander Ngoo,&nbsp;Penny L Jeffery,&nbsp;Ian Vela,&nbsp;Tony J Kenna,&nbsp;Elizabeth D Williams,&nbsp;Patrick B Thomas","doi":"10.1111/imcb.12829","DOIUrl":"10.1111/imcb.12829","url":null,"abstract":"<p>Treatments targeting the immune system only benefit a subset of patients with bladder cancer (BC). Biomarkers predictive of BC progression and response to specific therapeutic interventions are required. We evaluated whether peripheral blood immune subsets and expression of clinically relevant immune checkpoint markers are associated with clinicopathologic features of BC. Peripheral blood mononuclear cells isolated from blood collected from 23 patients with BC and 9 age-matched unaffected-by-cancer control donors were assessed using a 21-parameter flow cytometry panel composed of markers of T, B, natural killer and myeloid populations and immune checkpoint markers. Patients with BC had significantly lower numbers of circulating CD19⁺ B cells and elevated circulating CD4⁺CD8⁺ T cells compared with the control cohort. Immune checkpoint markers programmed cell death protein 1 (PD-1) and T-cell immunoglobulin and mucin-domain containing-3 (TIM-3) were elevated in the total peripheral immune cell population in patients with BC. Within the BC cohort, PD-1 expression in T and myeloid cells was elevated in muscle-invasive compared with non–muscle-invasive disease. In addition, elevated T, B and myeloid PD-1 cell surface expression was significantly associated with tumor stage, suggesting that measures of peripheral immune cell exhaustion may be a predictor of tumor progression in BC. Finally, positive correlations between expression levels of the various immune checkpoints both overall and within key peripheral blood immune subsets collected from patients with BC were observed, highlighting likely coregulation of peripheral immune checkpoint expression. The peripheral blood immunophenotype in patients with BC is altered compared with cancer-free individuals. Understanding this dysregulated immune profile will contribute to the identification of diagnostic and prognostic indicators to guide effective immune-targeted, personalized treatments.</p>","PeriodicalId":179,"journal":{"name":"Immunology & Cell Biology","volume":"102 10","pages":"949-962"},"PeriodicalIF":3.2,"publicationDate":"2024-10-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142542356","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":4,"RegionCategory":"医学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"SHORT-ROOT specifically functions in the chalazal region to modulate assimilate partitioning into seeds.","authors":"Meng Li, Qianfang Li, Shuang Li, Xufang Niu, Huimin Xu, Pengxue Li, Xinxin Bian, Zhichang Chen, Qian Liu, Hongxiang Zhang, Yunqi Liu, Shuang Wu","doi":"10.1111/tpj.17096","DOIUrl":"https://doi.org/10.1111/tpj.17096","url":null,"abstract":"<p><p>Nourishing the embryo with endosperm and enclosing both embryo and endosperm in the seed coat are two important evolutionary innovations. Seed coat is conventionally viewed as a protective layer that functions after the seed has matured. Here, we challenge this notion by showing that a subregion of the seed coat, termed the chalazal seed coat (CZSC), is geared to gate seed nutrition loading in developing seeds. The CZSC develops the coordinative system comprising the apoplastic isolation, mediated by the restricted suberization, and the active transport, mediated by the specific expression of a variety of transporters, at as early as the globular embryo stage in both Arabidopsis and soybean seeds. This coordinated system in the CZSC disrupts the vascular continuum to the maternal tissues and forces the nutrient transport into selective and active absorption. We further reveal that the precision of the spatiotemporal suberin deposition and transporter expression is controlled by the regulatory hierarchy of SHR-MYBs cascades. Our results provide a mechanistic insight into the assimilate accumulation in dicot seeds.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.2,"publicationDate":"2024-10-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142542441","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Modulation of Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus by Sphingomonas Sp Y503 via the CrMAPKKK1-CrMAPKK1/CrMAPKK2-CrMPK3 Signaling Cascade.","authors":"Xiaoxiao Gao, Xiaona Zhu, Zhiqin Wang, Xuejing Liu, Rui Guo, Jing Luan, Zhiwen Liu, Fang Yu","doi":"10.1111/pce.15253","DOIUrl":"https://doi.org/10.1111/pce.15253","url":null,"abstract":"<p><p>Catharanthus roseus is a highly relevant model for investigating plant defense mechanisms and the biosynthesis of therapeutically valuable compounds, including terpenoid indole alkaloids (TIAs). It has been demonstrated that beneficial microbial interactions can regulate TIA biosynthesis in C. roseus, highlighting the need to fully comprehend the molecular mechanisms involved to efficiently implement eco-friendly strategies. This study explores the effects of a novel microbial strain, Y503, identified as Sphingomonas sp., on TIA production and the underlying mechanisms in C. roseus. Through bioinformatics analysis, we have identified 17 MAPKKKs, 7 MAPKKs, and 13 MAPKs within the C. roseus genome. Further investigation has verified the presence of the MAPK module (CrMAPKKK1-CrMAPKK1/CrMAPKK2-CrMPK3) mediating Y503 in regulating TIA biosynthesis in C. roseus. This study provides foundational information for strengthening the plant defense system in C. roseus through advantageous microbial interactions, which could contribute to the sustainable cultivation of medicinal plants such as C. roseus.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.0,"publicationDate":"2024-10-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142542421","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}

{"title":"Identifying the gene responsible for non-photochemical quenching reversal in Phaeodactylum tricornutum.","authors":"Maxwell A Ware, Andrew J Paton, Yu Bai, Tessema Kassaw, Martin Lohr, Graham Peers","doi":"10.1111/tpj.17104","DOIUrl":"https://doi.org/10.1111/tpj.17104","url":null,"abstract":"<p><p>Algae such as diatoms and haptophytes have distinct photosynthetic pigments from plants, including a novel set of carotenoids. This includes a primary xanthophyll cycle comprised of diadinoxanthin and its de-epoxidation product diatoxanthin that enables the switch between light harvesting and non-photochemical quenching (NPQ)-mediated dissipation of light energy. The enzyme responsible for the reversal of this cycle was previously unknown. Here, we identified zeaxanthin epoxidase 3 (ZEP3) from Phaeodactylum tricornutum as the candidate diatoxanthin epoxidase. Knocking out the ZEP3 gene caused a loss of rapidly reversible NPQ following saturating light exposure. This correlated with the maintenance of high concentrations of diatoxanthin during recovery in low light. Xanthophyll cycling and NPQ relaxation were restored via complementation of the wild-type ZEP3 gene. The zep3 knockout strains showed reduced photosynthetic rates at higher light fluxes and reduced specific growth rate in variable light regimes, likely due to the mutant strains becoming locked in a light energy dissipation state. We were able to toggle the level of NPQ capacity in a time and dose dependent manner by placing the ZEP3 gene under the control of a β-estradiol inducible promoter. Identification of this gene provides a deeper understanding of the diversification of photosynthetic control in algae compared to plants and suggests a potential target to improve the productivity of industrial-scale cultures.</p>","PeriodicalId":6,"journal":{"name":"ACS Applied Nano Materials","volume":" ","pages":""},"PeriodicalIF":6.2,"publicationDate":"2024-10-30","publicationTypes":"Journal Article","fieldsOfStudy":null,"isOpenAccess":false,"openAccessPdf":"","citationCount":null,"resultStr":null,"platform":"Semanticscholar","paperid":"142542439","PeriodicalName":null,"FirstCategoryId":null,"ListUrlMain":null,"RegionNum":2,"RegionCategory":"材料科学","ArticlePicture":[],"TitleCN":null,"AbstractTextCN":null,"PMCID":"","EPubDate":null,"PubModel":null,"JCR":null,"JCRName":null,"Score":null,"Total":0}