Paragonimus westermani preadult fluke in a pulmonary necrotizing granulomatous lesion: A case associated with eating soy sauce-marinated raw freshwater crab, "gejang".

To the Editor, Pulmonary paragonimiasis is a parasitic disease caused by the Paragonimus species. Infection occurs by ingesting raw freshwater crabs contaminated with Paragonimus metacercariae or wild boar or wild deer meat contaminated with Paragonimus juvenile worms. Pulmonary lesions are local inflammatory reactions to the Paragonimus worms or eggs, characterized by rich eosinophils and necrotizing granulomas, and can form abscesses and cysts. In practice, pathologists rarely have the opportunity to investigate surgical specimen because paragonimiasis can be diagnosed in clinical settings, including typical symptoms, peripheral eosinophilia, and radiographic findings together with detecting Paragonimus eggs in sputum and/or fecal samples. Furthermore, treatment with oral praziquantel is usually successful, and surgical resection is generally unnecessary. Thus, there is limited information on the pathological findings of lung lesions in recent studies. Here, we describe a case of paragonimiasis with a necrotizing granulomatous lesion and a preadult fluke in the resected lung. Paragonimus species were identified by DNA sequencing using formalin‐fixed paraffin‐embedded tissues. A 60‐year‐old woman from Korea was admitted to our hospital for productive cough and hemoptysis for 4 months. The patient had peripheral blood eosinophilia (2100 cells/μL). Computed tomography showed a 28‐mm solitary nodule with peripheral spiculation in the right lower lobe (Figure 1a). Cytological examination of the sputum revealed prominent eosinophils, but neither malignant cells nor Paragonimus eggs were detected. She underwent a right lower lobectomy for a clinical diagnosis of lung cancer. At the cut surface of the formalin‐fixed lung, a 25 × 25mm brownish lesion with irregular single cavity formation was observed (Figure 1b). In addition, there was a 5‐mm long, flat ellipsoid, and light‐pink object in the cavity (Figure 1c). Histologically, the body had a periodic acid Schiff‐positive tegument, a pair of digestive tracts, and an excretory bladder. These findings suggested that the object was a fluke (Figure 1d). The pulmonary lesion showed necrotized granulomatous inflammation with infiltration of numerous eosinophils and plasma cells (Figure 1e), associated with numerous Charcot–Leyden crystals around the worm body (Supporting Information: Figure S1). There were no parasite eggs in the uterus of the worm or in the patient's tissue around the worm throughout the histological sections, while vitelline cells were noted in vitelline glands and vitelline ducts of the worm (Supporting Information: Figure S2). Moreover, there was no evidence of neoplastic lesions or bacterial and fungal colonies. These pathological findings suggested that the case was a pulmonary paragonimiasis of preadult stage. A multiple‐dot enzyme‐linked immunosorbent assay for the patient serum detected IgG antibodies for Paragonimus westermani and Paragonimus skrjabini miyazakii. To confirm the diagnosis of paragonimiasis and determine the Paragonimus species, we conducted a molecular phylogenetic analysis using DNA sequences of the nuclear ribosomal second internal transcribed spacer (ITS2) region. DNA extracted from the formalin‐fixed paraffin‐embedded lung tissue containing the parasite body was subjected to ITS2 polymerase chain reaction and sequencing. A nested PCR was carried out using an outer primer pair, 3S 5′‐GGTACCGGTGGATCACTC‐GGCTCGT G‐3′/A28 5′‐GGGATCCTGGTTAGTTTCTTTTCCTCC GC‐3′, and an inner primer pair, ENM264 5′‐CGAT GAAGAGCGCAGCCAAC‐3′/ENM265 5′‐CGCTTAGT GATATGC‐TTAAGTTCA‐3′. The resultant PCR products (463 bp in length) were subjected to sequence reactions with ENM264 and ENM265. The obtained sequence has been deposited in GenBank with accession number OQ880562. Almost full‐length ITS2 sequences (342 aligned positions) were used for the phylogenetic analysis. A phylogenetic tree (maximum