A GATEWAY™ Destination Vector For High-Throughput Construction of Neurospora crassa histidine-3 Gene Replacement Plasmids

Abstract

We report the construction of a Destination Vector, called pJHAM007, for the targeted integration of DNA sequences at the histidine-3 (his-3) locus of Neurospora crassa. pJHAM007 has all the necessary features required to perform a simple, rapid and efficient GATEWAYTM recombinational cloning with an Entry Clone to yield a his-3-gene replacement Destination Vector. Creative Commons License This work is licensed under a Creative Commons Attribution-Share Alike 4.0 License. This regular paper is available in Fungal Genetics Reports: http://newprairiepress.org/fgr/vol50/iss1/3 6 Fungal Genetics Newsletter A GATEWAYTM Destination Vector For High-Throughput Construction of Neurospora crassa histidine-3 Gene Replacement Plasmids Haag, Jeremy R., Lee, Dong, W ., and Aramayo, Rodolfo . Department of Biology, Washington University, Campus Box 1137, 1 Brookings Drive, St. Louis, M O 63130. Department of Biology, Texas A&M U niversity, Room 415 , Building BSBW , College Station, TX 77843-3258 We report the construction of a Destination Vector, called pJHAM007, for the targeted integration of DNA sequences at the histidine-3 (his-3) locus of Neurospora crassa . pJHAM007 has all the necessary features required to perform a simple, rapid and efficient GATEW AYTM recombinational cloning with an Entry Clone to yield a his-3-gene replacement Destination Vector. Fungal Genet Newsl 50:6-8 Gene replacement is a powerful tool to construct isogenic strains containing different DNA sequences integrated at the same chromosomal position. The most popular locus used for gene targeting in Neurospora crassa is of the metabolic gene histidine-3 (his-3). Several generations of plasmids for integration at this chromosomal position have been constructed (Sachs and Ebbole 1990 Fungal Genet. Newsl. 37: 35-36, Ebbole 1990 Fungal Genet. Newsl. 37: 15, M argolin, et al. 1997 Fungal Genet. Newsl. 44: 34-36, Aramayo and Metzenberg 1996 Fungal Genet. Newsl. 43: 9-13). Recently, we described the construction of a new set of N. crassa strains and plasmids that represent a significant improvement over previous systems because they allow the investigator to screen in one simple step for homokaryotic transformants containing the insertion of a test sequence among a population of primary histidine-independent transformants (Lee, et al. 2003 Curr. Genet. DOI 10.1007/s00294-002-0366-z). These new tools have significantly reduced the time it takes to construct new N. crassa strains. To expedite this system even further, we have designed and constructed a new plasmid, pJHAM 007, that can be used for the high-throughput cloning of DNA inserts, to generate his-3-gene replacement plasmids for d ifferent types of largeor smallscale genome analysis. Plasmid pJHAM007 is based on the GATEWAYTM system (Walhout, et al. 2000 Method . Enzymol. 328: 575-592). GATEWAYTM is a novel universal system for cloning and subcloning DNA sequences that uses phage lambda (8)-based sitespecific recombination (Landy 1989 Annu. Rev. Biochem. 58: 913-949). This Recombinational Cloning (RC) consists on two reactions: (1) The LR Reaction (attL X attR 6 attB + attP), mediated by the Integrase (Int), Integration Host Factor (IHF) and excisionase (Xis); and (2) the BP Reaction (attB X attP 6 attL + attR), mediated by the Int and IHF proteins. By providing different combinations of the recombination proteins and sites, the direction of the reaction can be easily controlled (Walhout, et al. 2000 Method . Enzymol. 328: 575-592, Hartley, et al. 2000 Genome Res. 10: 1788-1795). Escherichia coli DB3.1 and DH5" (Invitrogen, Carlsbad, CA, USA) were the hosts for bacterial manipulations. When nonmethylated DNA was needed for enzyme digestions, either GM2163--an E. coli K12 derivative containing, among others markers, dam13::Tn9 (Cam) and dcm-6 mutations (New England BioLabs (NEB), Beverly, MA, USA), or JM110--an E. coli K12 derivative containing, among o thers, dam and dcm mutations (Yanisch-Perron, et al. 1985 Gene 33: 103-119) was used. E. coli DB3.1 was routinely used to propagate plasmids. In contrast, E. coli DH5" was used only to propagate the p lasmid products of the BP and LR reactions. It is important to understand that Destination Vectors carrying the ccdB gene cannot propagate in E. coli DH5" and most E. coli strains, because the CcdB protein, a natural analogue of the quinolone antibiotics (e.g., ciprofloxacin, enoxacin, etc.), binds to the DNA gyrase subunit A, the product of the gyrA gene, turning it into a cellular poison (B ahassi, et al. 1999 J. B iol. Chem. 274: 10936-10944). E. coli strains DB3.1 and DH5" were routinely grown in LB liquid culture, or on LB agar p lates (15 g/l) containing the following antibiotics, as indicated in the text: ampicillin (Amp), 150 :g/ml; chloramphenicol (Cm), 30 :g/ml; kanamycin (Km), 50 :g/ml. Most DNA manipulations were done following standard procedures as described (Sambrook, et al. 1989, Ausubel, et al. 1987, Pratt and Aramayo 2002 Fungal Genet. Biol. 37: 56-71). For DNA sequencing we used the BigD yeTM Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA polymerase (PEB iosystems, Foster City, CA, USA). Sequences were generated on an Applied Biosystems Model 377 or 373 automated DNA sequencer at GeneT echnologies Laboratory (Institute of Developmental and M olecular Biology—IDMB , Texas A&M University, College Station, TX, USA). PCR reactions were performed in 50 :l reactions for 40 cycles (94°C, 30 s; 60.8°C, 30 s; 68°C, 9.5 min) with the Clontech Advantage 2 PCR System (BD Biosciences Clontech, Palo Alto, CA, USA) using the manufacturer’s specifications. To amplify the 9,001 bp chromosomal DNA region containing the N. crassa NCU02764.1 gene, we used two primers: OJHAM013 (5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTcgcgaacgtagaaggattattaggcaaagt-3') and OJHAM014 (5'GGGGACCACTTTGTACAAGAAAGCTG GGTgtcagtcagtcagtcagtcagtcaaccagt-3'). The 29 upper-case characters correspond to the attB1 and attB2 primer sequences present in OJHAM 013 and O JHAM 014, respectively. The 30 lower-case characters correspond to the priming sites of the oligonucleotides in the N. crassa chromosomal region. After PCR, the resulting PCR products were purified from attB primers and attB primer-dimers by either using PEG precipitation (30% (w/v) PEG 8000/30 mM MgCl2, as recommended by Invitrogen), or extraction from a 1% (w/v) agarose gel and purification with the Wizard PCR Preps DN A Purification Resin as recommended by Promega (Promega, Madison, WI, USA). Published by New Prairie Press, 2017