Expanding the Phenotype of DNA Ligase 1 Deficiency: First Report of Macrocytic Sideroblastic Anemia

Abstract

DNA Ligase 1 (LIG1) is 1 of 3 ATP-dependent DNA ligases expressed in vertebrates that play a key role in DNA replication by joining Okazaki fragments [1]. LIG1 also mediates single-strand DNA repair by catalyzing the final step of the base excision repair pathway and has a redundant function alongside LIG3 in mediating alternative end-joining of double-strand DNA breaks. LIG1 deficiency is a rare inborn error of immunity reported in 8 cases to date that is typically characterized by recurrent infections, early-onset hypogammaglobulinemia, and erythrocyte macrocytosis [2-4]. Seven of the 8 prior cases feature variants affecting coding regions that result in impaired LIG1 catalytic activity [2]. The remaining patient presented with severe combined immunodeficiency and Omenn-like erythematous-exfoliative skin lesions and was found to have a novel splice variant (c.776+5G>T) leading to a shift in reading frame and a premature stop codon [4]. Here, we report on 2 cases of LIG1 deficiency that presented with macrocytic sideroblastic anemia, a phenotype not previously recognized in this disease. Additionally, Patient 1 is the first reported case of LIG1 deficiency diagnosed in adulthood.

Patient 1 is a 37-year-old female of Northern European ancestry who was referred to adult hematologic care with a long-standing history of a mild underproduction macrocytic anemia (hemoglobin [Hb] 11.6 g/L; mean corpuscular volume [MCV] 125 fL) with normal vitamin B12 and folate levels. She had a history of recurrent sinopulmonary infections as a child, including several hospitalizations for community-acquired pneumonias, seizure disorder, moderate-persistent asthma, mild obstructive sleep apnea, and attention-deficit/hyperactivity disorder. Her mother died at age 64 from complications related to transverse myelitis; a full brother and 2 maternal half-sisters are healthy (Figure 1A). Bone marrow aspirate and biopsy showed a normocellular marrow for age with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.6:1) associated with dyserythropoiesis in a subset of erythroids, including nuclear irregularities, binucleation, and budding, as well as megaloblastic maturation. Iron stain revealed > 15% ring sideroblasts (Figure 1C). Flow cytometry on the marrow identified no abnormal myeloid, B, or T cell populations, and routine karyotype was 46, XX. Clinical ALAS2 sequencing was negative. She had hypogammaglobulinemia (Table S1). Immunophenotyping showed mildly reduced CD19+ B cells, normal numbers of CD27+ memory B cells, and reduced immunoglobulin (Ig) class-switching with low IgM/IgD memory cells and virtual absence of IgA+ and IgG+ class-switched memory B cells. Vaccination titers were protective for only 3 of 23 pneumococcal serotypes. T and NK cell numbers were normal, and response to mitogen stimulation with phytohemagglutinin and CD3 was normal. The patient was started on replacement immunoglobulin. She developed SARS-CoV-2 infection 1 year after completing the primary series of the mRNA-1273 vaccine and was successfully managed with antiviral therapy as an outpatient.

Patient 2 is a 4-year-old male of European ancestry who was referred with 3.5 years of a mild underproduction macrocytic anemia (Hb 11.3 g/dL, MCV 100.6 fL) in the absence of B12, folate, or iron deficiency. He had a history of seasonal allergies and reactive airway disease that was well controlled on fluticasone propionate. His growth and height velocity were normal, tracking along the 5th to 10th percentiles. His mother had a history of thrombocytopenia in pregnancy; his father and 1-year-old sister are healthy (Figure 1B). There was no family history of congenital anemia or immunodeficiency. Workup revealed lymphocytopenia (ALC 1.3 thou/μL) and a normal hemoglobin electrophoresis. Targeted capture next-generation sequencing for hereditary anemias did not identify any pathogenic variants. Bone marrow aspirate and biopsy showed a hypercellular marrow for age with trilineage hematopoiesis with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.5–1:1) and dyserythropoiesis. Iron staining revealed > 15% ring sideroblasts (Figure 1D). Flow cytometry revealed no abnormal myeloid, B, or T cell populations, and routine karyotype was 46, XY. He was found to have low IgG2, elevated IgG3 and IgA, and low CD4+ T cells (Table S1).

Both patients were referred for whole exome sequencing on a research basis after ruling out the most common genetic causes of congenital sideroblastic anemia and acquired causes such as myelodysplastic syndrome, nutritional deficiencies, alcohol use, and medications associated with sideroblastic anemia. Patient 1 was found to have compound heterozygous LIG1 mutations (c.1922G>T, p.R641L and c.776+5G>T, NM_000234.3) that were confirmed to be in trans by PacBio long-range genomic sequencing [5]. The missense mutation, R641L, disrupts an important DNA binding loop in the protein and has been reported in 2 prior cases [2]. The second intronic mutation (c.776+5G>T) has been previously reported in a single individual with LIG1 deficiency and was shown to affect mRNA splicing, resulting in an insertion of 16 nucleotides in intron 9, leading to a premature protein synthesis termination at position 260 [4]. Patient 2 was found to also carry this intronic mutation and to harbor a second known pathogenic variant (c.2311C>T, p.R771W) that has been reported in 4 prior cases [2].

To confirm that the c.776+5G>T allele impacts splicing [4], we designed reverse transcriptase polymerase chain reaction (RT-PCR) primers (LIG1_F: CAGGAGGAGGAAGAGCAGAC; LIG1_R: CAGGCATCTTCCACGGGAT) spanning the splice junction between exon 9 and 10. Gel electrophoresis of RT-PCR amplicons showed a larger splicing product in Patient 1 (Figure 1E). Next-generation sequencing of this amplicon identified a 16-base pair insertion in transcripts derived from the c.776+5G>T allele (c.776ins16) predicted to result in a frameshift and termination present in ~36% of the reads. It is unclear if this decreased transcript abundance is secondary to reduced efficiency of splicing at the normal splice donor site or nonsense-mediated decay of the aberrantly spliced mRNA. Whatever the mechanism, this finding supports the notion that the c.776+5G>T allele is a genetic hypomorph.

This is the first report of ring sideroblasts in LIG1 deficiency. Unlike the 8 previously described cases, these 2 patients presented for evaluation of sideroblastic anemia rather than for a history of early-onset immunodeficiency [2-4]. Congenital sideroblastic anemias are defined by the abnormal deposition of iron in the perinuclear mitochondria of erythroid precursor cells. These anemias can be categorized based on red blood cell size. Those with microcytosis are typically caused by defects in heme synthesis or iron-sulfur cluster biogenesis. In contrast, macrocytosis is generally associated with defects in mitochondrial translation or respiration [6]. The mechanism underlying the formation of macrocytic sideroblastic anemia in these cases of LIG1 deficiency is unknown. LIG1 is not known to localize to mitochondria, and LIG3 is the only DNA ligase found in mammalian mitochondria [1]. Importantly, neither of the patients in this report showed evidence of excessive somatic heteroplasmic mitochondrial DNA variants, which argues against a major impact of LIG1 deficiency on mitochondrial DNA replication and repair. Macrocytic anemia has been documented in all previously reported cases of LIG1 deficiency. This has been hypothesized to result from megaloblastic anemia due to defects in DNA synthesis. However, none of the earlier cases were evaluated for the presence of ring sideroblasts [2-4]. This raises the possibility that these patients may also have had sideroblastic anemia that went undiagnosed.

Both patients reported here also had mild clinical phenotypes. Patient 1 is the first reported case of LIG1 deficiency diagnosed in an adult patient. Previously published cases of LIG1 deficiency featured early-onset immunoglobulin production defects and severe combined B and T cell deficiencies requiring hematopoietic stem cell transplantation [2-4]. LIG1 mutant alleles are known to exhibit variably deficient enzymatic function that appears to correlate with disease severity [2]. Here, both patients harbored one missense variant that results in reduced LIG1 activity and a splice site variant, which may allow for some residual wild-type enzyme activity, accounting for the relatively mild clinical presentations. This report broadens the clinical spectrum of LIG1 deficiency and highlights the increasing awareness that inborn errors of immunity may manifest with a wide range of immunological features and varying degrees of disease severity. As the immune deficiency can be subtle, LIG1 deficiency should be considered in the differential diagnosis of patients presenting to hematologists with macrocytic sideroblastic anemia.

D.J., E.V.S., M.D.F., and S.B.K. contributed to the data collection, data analysis, and writing of the manuscript. K.R. contributed to the data collection. D.R.C. performed all technical experiments. S.D. performed genomic analysis. All authors contributed to critical revisions and provided approval of the submitted and final versions of the manuscript.

All procedures were performed in accordance with the ethical standards of the Boston Children's Hospital, University of Washington, and Connecticut Children's Medical Center Institutional Review Boards, and with the Helsinki Declaration of 1975.

The authors declare no conflicts of interest.