Algorithms based on PCR-RFLP of nad1 gene for genotyping of Echinococcus granulosus from human and animal isolates in Egypt

Background: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) is a simple rapid method for genotyping of Echinococcus garnulosus sensu lato (E. granulosus s. l.) in developing countries. Construction of algorithms based on PCR-RFLP using two restriction enzymes would be useful to study the genetic diversity of the parasite and would help in differentiation between ambiguous genotypes. Objective: The goal of the present work was to develop algorithms based on RFLP of nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 1 (nad1) sequences of reference genotypes of E. granulosus retrieved from GenBank for genotyping of human and animal isolates of E. granulosus in Egypt. Subjects and Methods: Retrieved nad1 sequences of reference genotypes were digested in silico individually with two restriction enzymes; Haemophilus influenza (HinfI) and Haemophilus aegyptius (HaeIII). The constructed PCR-RFLP algorithms were used for genotyping of 50 human and animal isolates (19 human, 23 camels and 8 pigs) analyzed by PCR-RFLP. To confirm the validity PCR-RFLP algorithms, samples corresponding to determined and undetermined genotypes as inferred from the algorithms were sequenced. Results: Utilizing PCR-RFLP and sequencing revealed that except for two cases (12.5%) which were typed as G1 among humans and one case as G5 in pigs (12.5%), G6 was the commonest genotype among human, camel and pig isolates collected. Conclusion: The algorithms based on PCR-RFLP of nad1 are valuable tools for genotyping of E. granulosus s. l. especially with HinfI RFLP algorithm. Sequencing is still needed to reveal the genotypes of undetermined or ambiguous isolates. E. granulosus genotyping Nasser et al., 279 and pig samples shared the same digestion pattern I, while pattern II appeared exclusively in two human cases (14.3%) out of the 14 typed[11]. However, the application of PCR-RFLP patterns is not broadly used as a result of heterogeneity of Echinococcus genome within different regions of the world. Consequently, designing and conducting a standardized pattern should be interpreted indigenously, to avoid unexpected mutations (such as nucleotide change/insertion or deletion) within the parasite genome[10]. Furthermore, a practical algorithm using more than one restriction enzyme should be constructed for interpretation of PCR-RFLP results[12]. In silico computer-based methods are rapid techniques widely used nowadays for genotyping of microorganisms, that are accurate and less costly[13]. They are facilitated by the great plethora of partial and complete sequences deposited in gene banks from wide geographical areas, as well as the availability of large numbers of analytical software. In silico PCRRFLP was used for genotyping of several parasites like T. vaginalis[14], and Leishmania spp.[15] Some in silico studies were developed for genotyping of Echinococcus spp., where gene sequences retrieved from GenBank were cut with specific restriction enzymes to create a virtual RFLP pattern for genotypic differentiation[10,16]. Retrieval of the sequences of nad1 gene of E. granulosus reference genotypes from GenBank, and their in silico digestion with restriction enzymes using RFLP software would allow the building of practical algorithms for genotyping of E. granulosus isolates using the expected obtained digestion patterns. Hence, the aims of the present study were to build practical algorithms based on in silico digestion of sequences of mitochondrial nad1 gene of reference genotypes of E. granulosus by two commonly used restriction enzymes, HinfI and HaeIII. The constructed algorithms will be used for genotyping of Egyptian isolates of E. granulosus using PCR-RFLP. Subsequently, the results inferred from PCR-RFLP will be confirmed by DNA sequencing of selected samples representing the different RFLP patterns. SUBJECTS AND METHODS The present descriptive analytical study was conducted during the period from June 2018 to August 2019 at the Parasitology Department, Faculty of Medicine, Ain Shams University, Cairo, Egypt. Study Design: The sequences of nad1 gene of E. granulosus reference genotypes were digested with two commonly used restriction enzymes, HinfI and HaeIII, by means of in silico software program. The resulting restriction patterns were used for construction of practical algorithms to identify the different genotypes. Following DNA extraction from Egyptian human and animal isolates of E. granulosus, the nad1 gene was amplified and digested with the individual restriction enzymes. The genotype of the isolates was determined from the constructed in silico algorithms. To confirm the validity PCR-RFLP algorithms, samples corresponding to determined and undetermined genotypes as inferred from the algorithms were sequenced. Construction of algorithms based on RFLP of retrieved nad1 gene of E. granulosus reference genotypes: Initially, the complete mitochondrial genome of E. granulosus G1 (AF297617) genotype was retrieved from the National Center for Biotechnology Information (NCBI) GenBank. The nucleotide sequence (1071-1078 bp) representing the nad1 gene amplification region, according to Huttner et al.[17], was subsequently checked by applying the flanking primers on the complete mitogenome utilizing Primer-Map (www.bioinformatics.com). The deduced sequence was then aligned with the complete mitogenome of other genotypes "G3-G10" and E. felidis retrieved from the GenBank with the following accession numbers AF297617, KJ559023, AF346403, AB235846, AB208063, AB235847, AB235848, AB745463, and AB732958[18-20], utilizing the clustalW multiple alignment method within Geneious 10.1.3 software program. Inferred reference sequences were digested by HinfI and HaeIII restriction enzymes using “restriction sites” tool within Geneious 10.1.3 software program. Interpretation algorithms for the generated patterns were eventually constructed for genotyping of E. granulosus from human and animal isolates. Samples’ collection and parasitological examination: Fifty samples (19 humans, 23 camels and 8 pigs) that were used in our previous study[11] were included in the present study. Human samples were collected from Abdominal Ultrasonography Unit of Tropical Medicine Department, Kasr El-Aini Hospital, Cairo University, and from departments of Tropical Medicine, General Surgery and Cardiothoracic Surgery, Faculty of Medicine, Ain Shams University. Animal samples included 23 pulmonary camel and 8 hepatic pig cysts from condemned organs of camels and pigs slaughtered in Cairo Abattoir. Protoscolices from hydatid fluid samples were collected by centrifugation. For individual infertile cysts, the germinal layer was collected under aseptic conditions. Collected materials were washed three times with sterile saline solution and fixed in 95% ethanol until further molecular analysis. DNA extraction and PCR amplification of nad1 gene from human and animal samples: DNA extraction was done using "QIAamp® DNA Mini Kit" (Qiagen, Hilden, Germany) according to manufacturer's specifications. PCR amplification of a 1071-1078 bp fragment including the complete nad1 gene was performed according to Huttner et al.[17] using a forward primer: 5 ́ TATTAAAAATATTGAGTTTGCGTC-3 ́ and a reverse PARASITOLOGISTS UNITED JOURNAL 280 primer: 5 ́ TCTTGAAGTTAACAGCATCACGA T 3 ́, as previously described[11]. RFLP of the amplified nad1 gene: HinfI and HaeIII restriction endonucleases were used individually to digest the purified PCR product of the nad1 gene according to Chaâbane-Banaoues et al.[16]. Digestion was performed according to the manufacturer’s instructions (Promega). HinfI cut through a five base palindromic restriction site “GANTC”, while HaeIII cut through a four base palindromic restriction site “GGCC”. DNA sequencing and sequences analysis: Seven samples from 3 humans, 2 camels, and 2 pigs, represented the different genotypes deduced from the PCR-RFLP algorithms; and 4 samples from 1 human and 3 camels with undetermined genotypes according to the algorithms, were subjected to automated DNA sequencing based on Sagner technique[21]. Amplified PCR products were primarily purified using the QIAquick PCR purification kit according to the manufacturer’s protocol. The BigDye Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems, Life Technologies, USA) was utilized. Acquired sequences were first edited to create consensus sequences and reviewed for their reliability using Geneious 10.1.3 software. Basic Local Alignment Search Tool (BLAST) algorithm was used for homology searches. Ethical consideration: The research protocol was approved by the Ethics Committee of the Faculty of Medicine; Ain Shams University that complies with the 1964 Helsinki Declaration and regulations of the Egyptian Ministry of Higher Education. An oral consent from human subjects who participated in the study was obtained after a clear explanation of the study objectives. Patients with hydatid disease were already diagnosed and treated by surgery, PAIR combined with albendazole chemotherapy. Hydatid cysts were collected from slaughtered animals during inspection by veterinary officers at Cairo Abattoir, after approval from the authority of the slaughterhouse. No experiment was conducted on live animals. RESULTS Construction of algorithms based on RFLP of retrieved nad1 gene of E. granulosus s. l. reference genotypes: Algorithms were constructed. using the HinfI and HaeIII restriction endonucleases. Table (1) and figures (1-3) demonstrate the numbers of fragments, digestion position from 5' end and size of fragments (bp). According to the algorithm, HinfIRFLP of nad1 gene had greater discriminatory power in genotyping of E. granulosus s. l. than HaeIII-RFLP. However, HinfI could not differentiate between G1-G3, or G6/G7, or G8 from E. felidis. Besides, HaeIII could not differentiate between G1-G3, or G5, G6/G7, G8, G10, or G4 from E. felidis. At the level of the two enzy