Sequencing and gene expression studies for Al tolerance in contrasting genotypes of tropical maize

Abstract

: The aims of this study were to evaluate the homology of the ZmMATE1 and ZmMATE2 gene sequences with those deposited in the international banks of sequences and quantify the differential expression of the genes ZmMATE1, ZmMATE2, and ZmNrat1 in germplasms of landrace and hybrid maize under aluminum (Al) stress in minimal solution. Fifty-two hybrids from different companies and 50 landrace varieties were genotyped for the genes ZmMATE1 and ZmMATE2. For studies of gene expression, the tolerant (H 44 and V 18) and the sensitive (H 22 and V 25) genotypes were exposed to minimal solution containing 4 mg L -1 of Al for different periods (0, 1, 3, 6, 9, 12, 24, and 48 h). The results showed greater differential expression in the tolerant V 18 landrace variety of the gene ZmMATE1, indicating that exudation of citrate may be the main mechanism of Al tolerance in this genotype. device and diluted to a concentration of 10 ng mL -1 . The genomic regions surrounding the oligonucleotides that represent the genes ZmMATE1 and ZmMATE2 identified by Maron et al. (2010) were used to detect the presence of amplified fragments through polymerase chain reaction (PCR) in the two maize germplasms studied. The forward primer 5’CCGGATGTTTGCTGGATTTT3’ and the reverse primer 5’TGGCCAAA TCGACCATGATT3’ were used in the respective germplasms for detection of the gene ZmMATE1 . The gene ZmMATE2 was amplified using the pair of the forward primer 5’GCAGTTCGTACGTAGTGGTG3’ and the reverse primer 5’AGTACGTAGCTAGGCGATGC3’.