Author Correction: Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells

Abstract

Correction: Genome Biol 24, 89 (2023)

https://doi.org/10.1186/s13059-023–02928-7

Following publication of the original article [1], the authors identified an error in one of the guide RNA spacer sequences disclosed in Supplementary Table S3. The correct sequence for base editing mediated silencing of the CIITA is 5’−3’: CACTCACCTTAGCCTGAGCA, as originally described in Gaudelli et al. 2020 [2].

This error does not affect the main results and conclusions of the paper.

The Supplementary Table S3 of the original article [1] has been corrected.

1. Glaser V, Flugel C, Kath J, et al. Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells. Genome Biol. 2023;24:89. https://doi.org/10.1186/s13059-023-02928-7.

   Article CAS PubMed PubMed Central Google Scholar

2. Gaudelli NM, Lam DK, Rees H, et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol. 2020;38:7. https://doi.org/10.1038/s41587-020-0491-6.

   Article CAS Google Scholar

Download references

Authors and Affiliations

1. Berlin Center for Advanced Therapies (Becat), Charité – Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität Zu Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

   Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke & Dimitrios L. Wagner

2. BIH Center for Regenerative Therapies (BCRT), Berlin Institute of Health at Charité – Universitätsmedizin Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

   Viktor Glaser, Christian Flugel, Jonas Kath, Weijie Du, Vanessa Drosdek, Clemens Franke, Maik Stein, Michael Schmueck-Henneresse, Hans-Dieter Volk, Petra Reinke & Dimitrios L. Wagner

3. Institute of Transfusion Medicine, Charité – Universitätsmedizin Berlin, corporate member of Freie Universität Berlin and Humboldt-Universität zu Berlin, Campus Charité Mitte, Charitéplatz 1, Berlin, 10117, Germany

   Axel Pruß & Dimitrios L. Wagner

4. Institute of Medical Immunology, Charité – Universitätsmedizin Berlin, Corporate Member of Freie Universität Berlin and Humboldt-Universität Zu Berlin, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

   Hans-Dieter Volk & Dimitrios L. Wagner

5. CheckImmune GmbH, Campus Virchow Klinikum, Augustenburger Platz 1, Berlin, 13353, Germany

   Hans-Dieter Volk

Authors

1. Viktor GlaserView author publications

   You can also search for this author inPubMed Google Scholar

2. Christian FlugelView author publications

   You can also search for this author inPubMed Google Scholar

3. Jonas KathView author publications

   You can also search for this author inPubMed Google Scholar

4. Weijie DuView author publications

   You can also search for this author inPubMed Google Scholar

5. Vanessa DrosdekView author publications

   You can also search for this author inPubMed Google Scholar

6. Clemens FrankeView author publications

   You can also search for this author inPubMed Google Scholar

7. Maik SteinView author publications

   You can also search for this author inPubMed Google Scholar

8. Axel PrußView author publications

   You can also search for this author inPubMed Google Scholar

9. Michael Schmueck-HenneresseView author publications

   You can also search for this author inPubMed Google Scholar

10. Hans-Dieter VolkView author publications

    You can also search for this author inPubMed Google Scholar

11. Petra ReinkeView author publications

    You can also search for this author inPubMed Google Scholar

12. Dimitrios L. WagnerView author publications

    You can also search for this author inPubMed Google Scholar

Corresponding author

Correspondence to Dimitrios L. Wagner.

Additional file 2: Supplementary Tables

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

Cite this article

Glaser, V., Flugel, C., Kath, J. et al. Author Correction: Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells. Genome Biol 26, 71 (2025). https://doi.org/10.1186/s13059-025-03548-z

Download citation

• Published: 26 March 2025

• DOI: https://doi.org/10.1186/s13059-025-03548-z

Share this article

Anyone you share the following link with will be able to read this content:

Get shareable link

Sorry, a shareable link is not currently available for this article.

Copy to clipboard

Provided by the Springer Nature SharedIt content-sharing initiative